Impromii reverse transcriptase system

Gene expression for TLR2, -4, and -9 as well as VEGF and PDGF was determined using quantitative real-time PCR (RT-qPCR). For analysis of pancreatic tissue samples human pancreatic matched cDNA was purchased from Pharmingen (Heidelberg, Germany) and used as a control. Total cellular RNA was extracted using RNeasy Minikit (Qiagen, Hilden, Germany) on the QIAcube platform (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed using ImProm-II reverse transcriptase system (Promega, Mannheim, Germany) and carried out on a Eppendorf Mastercycler (Eppendorf, Hamburg, Germany). qPCR was performed using Taqman Gene Expression Master Mix (Life Technologies, Carlsbad, CA, USA) and Taqman Gene Expression Assays (Life Technologies) in concordance to the manufacturer’s instructions and carried out in duplicates on a Biorad CFX96 Touch Real-Time PCR Detection System. Reproducibility was assured by three independent measurements. Housekeeping genes β-actin, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), and β2-microglobulin (B2M) were used for calculation of the relative quantification value, fold difference, which is expressed as 2^−ΔΔCq.

Total RNA was isolated from HCC cells and patient tissues using TRIzol reagent (Invitrogen). cDNA was synthesized from total RNA using the ImProm-II™ Reverse Transcriptase system (Promega) according to the manufacturer’s protocol and a previous study.^{56 (link),57 (link)} The mRNA levels were measured by quantitative real-time PCR (RT-qPCR), which was performed in an ABI 7500 Real-time PCR system using SYBR Green PCR Master Mix (Applied Biosystems). The qPCR primers used are as follows: 5′-CCCGAAGAAGACGTAGAAGATGAC-3′ and 5′-CCCGAAGAAGAGGTGGAGGACGAC-3′ (Tbx3), 5′-CCACCAAAGTCACGCTGAA-3′ and 5′–TGCTTGGATTCCAGAAACG-3′ (E-cadherin), 5′-CGGAACAAGGAGAAGAG CAA-3′ and 5′- GCTCAGCCACCTTCTGTTTTA-3′ (HDAC5), and 5′-TCCATGACAAC TTTGGTATCG-3′ and 5′-TGTAGCCAAATTCGTTGTCA-3′ (GAPDH). Serial 1 to 10 dilutions of plasmid DNA (pIRES-Tbx3, pcDNA-E-cadherin, pCRII-GAPDH) were used as standards for the absolute quantification of each cDNA. The amount of target gene expression could be calculated from the standard curve, which plotted the cycle threshold (Ct) value and the corresponding value of the amount of input DNA.^{58 (link)}

Gene expression of PDGFRα, PDGFRβ, VEGFR1, and VEGFR2 was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR). An ImPromII reverse transcriptase system (Promega, WI, USA), and an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) were used to obtain complementary DNA (cDNA). TaqMan gene expression assays were purchased from Thermo Fisher Scientific (Waltham, MA, USA). All samples were assayed in duplicates and normalized during data analysis. β-Actin, 18 SrRNA, and RPLP0 (ribosomal protein lateral stalk subunit P0) were used as housekeeping genes for relative quantification. Tissue sample results were normalized to normal colon tissue (purchased from Biochain, Hayward, CA, USA). The relative quantification value is expressed as 2^−ΔΔCq. PCR analysis was conducted with a BioRad CFX96 Touch real-time PCR detection system.

As previously described [65 (link)], RNA extraction for cell samples was performed using TRI Reagent with a Direct-zol-96 RNA Kit (Zymo Research), following the manufacturer’s protocol. The ImProm-II reverse transcriptase system (Promega) was used with random hexamers and 5 μL of extracted RNA to synthesize cDNA. qPCR assays for VSV were performed using SYBR dye and primers targeting VSV-N (primer 1: 5′-TGTCTACCAAGGCCTCAAATC-3′; primer 2: 5′-GTGTTCTGCCCACTCTGTATAA-3′). Predesigned PrimeTime qPCR assays (IDT) were used to quantify expression of human genes: ACTB (Hs.PT.39a.22214847), LRRC15 (Hs.PT.58.26559170), MX1 (Hs.PT.58.26787898), and IFI44 (Hs.PT.58.21412074). A standard curve was used to determine absolute gene copy. qPCR results were normalized to the housekeeping gene ACTB.

As previously described [65 (link)], RNA was isolated from stool using a ZR-96 Viral RNA kit (Zymo Research, Irvine, CA). RNA from tissues or cells was isolated using TRI Reagent with a Direct-zol-96 RNA kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol. For RNA extraction from blood, 250 μl of blood was harvested via submandibular bleed into EDTA-coated tubes. 125 μl was aliquoted as “whole” blood. The other 125 μl was transferred into a 1.5 mL microcentrifuge tube and centrifuged at 10,000xg for 5 minutes at 4°C. The supernatant was removed and served as “serum”. The pellet, serving as “cells”, was washed once in 1 volume of DPBS and then resuspended in 1 volume of DPBS for RNA extraction. Following this separation, RNA was extracted as described above using the Direct-zol-96 RNA kit. 5 μl of RNA from stool or tissue was used for cDNA synthesis with the ImPromII reverse transcriptase system (Promega, Madison, WI). MNoV TaqMan assays were performed, using a standard curve for determination of absolute viral genome copies, as described previously [77 (link)]. Quantitative PCR for housekeeping genes Rps29 or Actin was used to normalize absolute values of MNoV as previously described [33 (link),63 (link)]. All samples were analyzed with technical duplicates.

Total RNA was extracted from api-AuNPs-treated and untreated KKU-M055 cells using GF-1 total RNA extraction kit (Vivantis Technologies, Selangor, Malaysia) according to the manufacturer's instructions. The first strand complementary DNA (cDNA) was synthesized by reverse transcription with oligo d(T) primers using the Improm II™ reverse transcriptase system (Promega). RT-PCR was performed to detect the expression level of apoptotic genes (Bax, Bid, and Caspase 3), pro-survival gene (Bcl-2) and reference gene (Actin), using a Toptaq Master Mix Kit (Qiagen, Hilden, Germany). The PCR reaction of the above genes was carried out in a T100 Thermal Cycler PCR system (Bio-Rad Laboratories, Hercules, CA, USA) using the primer sequences as shown in Table 1.Table 1

Primer sequences for RT-PCR.

Table 1

Genes	Forward primer sequences (5′–3′)	Reverse primer sequences (5′–3′)	Product size (bp)
Bax	CATCCAGGATCGAGCAGG	CATGTCAGCTGCCACTCGG	208
Bid	CAAGAAGGTGGCCAGTCACAC	GCTCCGTCTACTCTGGAAGC	199
Caspase 3	GTTGATGATGACATGGCGTG	GTTGCCACCTTTCGGTTAA	203
Bcl-2	GACTTCGCCGAGATGTCCAG	GTTCAGGTACTCAGTCATCCA	216
Actin	CTCCTCCCTGGAGAAGAGCT	GCAATGCCAGGGTACATGGT	231