The apical parts of the plants were used to quantify the gene expression of ASR1 (ABA stress ripening protein 1)—a marker gene for ABA—and PIN2 (proteinase inhibitors 2), a marker gene for JA. Immediately after collection, apical samples were ground in liquid nitrogen and a portion of them served for RNA extraction. Plant RNA Kit (Omega Bio-TekInc, Doraville, GA, USA) was used to extract total RNA (1.5 μg), and RNase-free DNase (Promega Corporation, Madison, WI, USA) was employed to eliminate genomic DNA contamination. Reverse transcription, primers, and the PCR SYBR Green reaction were carried out as previously described by Pérez-Hedo, et al. [21 (link)]. Quantitative PCR was performed with the Smart Cycler II (Cepheid, Sunnyvale, CA, USA) sequence detector using standard PCR conditions. Expression of EF1 (Elongation factor 1) was used for normalization as housekeeping gene. Table 1 describes the sequences of the gene-specific primers used.
Smart cycler 2
Manufactured by Cepheid
Sourced in United States
The Smart Cycler II is a compact, real-time PCR (polymerase chain reaction) system designed for rapid and accurate sample analysis. It features a high-performance thermal cycler and advanced optics for sensitive detection of target DNA sequences. The Smart Cycler II enables efficient nucleic acid amplification and quantification in a user-friendly, self-contained platform.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Quantitect probe rt pcr kit, by Qiagen (3 mentions)
Superscript 3 rt pcr kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Abi 7500 fast thermocycler, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Tri reagent, by Merck Group (2 mentions)
Rnase free dnase, by Promega (1 mentions)
Plant rna kit, by Omega Bio-Tek (1 mentions)
Hiperfect transfection reagent, by Qiagen (1 mentions)
Sv rna isolation system, by Promega (1 mentions)
On targetplus non targeting pool, by Horizon Discovery (1 mentions)
Superscript 3 platinum sybr green one step rt pcr kit, by Thermo Fisher Scientific (1 mentions)
Ax sym hcv 3, by Abbott (1 mentions)
Superscript 3 platinum sybr green one step qrt pcr kit, by Thermo Fisher Scientific (1 mentions)
Sv rna isolation kit, by Promega (1 mentions)
Onestep rt pcr kit, by Qiagen (1 mentions)
7500 fast, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Merck Group (1 mentions)
39 protocols using smart cycler 2
1
Quantifying ABA and JA Marker Genes
2
Quantifying miR-31 Expression in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells or tissues were harvested with Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and total RNA was isolated according to the manufacturer's instructions. cDNA synthesis was performed using the Superscript III RT-PCR kit (Invitrogen). Real-time PCR was performed using a Cepheid SmartCycler II (Sunnyvale, CA, USA) with gene-specific real-time PCR primers. Specifically, stem-loop real-time RT-PCR was used to analyze the expression of miR-31. Relative quantification (RQ) of selected genes and miR-31 expression was normalized with respect to GAPDH and U6 respectively. Corresponding adjacent esophageal tissues were used as calibrator samples. The expression of the target gene was calculated using the equation 2-ΔCt, where ΔCt = (Ct target gene – Ct reference gene). The relative expression of target genes in carcinoma tissue was calculated by 2-Δ ΔCt, where Δ ΔCt = (ΔCt target gene in the tumor tissue – ΔCt target gene in the adjacent normal tissue). Data were presented as log10 of the relative quantification equal to the fold-change of gene expression in ESCC tissue compared to its corresponding adjacent esophageal tissue. High or low p21 expression was defined as its expression was higher or lower compared to corresponding adjacent esophageal tissue. The primers for PCR are list in supplementary table 2 .
3
RNA Isolation and Real-Time PCR Analysis
4
Norovirus Detection via Real-Time RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 10% stool suspension was prepared by mixing each stool sample with phosphate-buffered saline, followed by centrifugation at 10,000 × g for 10 min at 4°C. Viral RNA was extracted from the supernatants with the RNeasy Mini Kit (Qiagen, Hilden, Germany). Real-time RT-PCR detection of NoV was performed with a Smart-Cycler II (Cepheid, Sunnyvale, CA, USA) using a QuantiTect Probe RT-PCR Kit (Qiagen) with separate reactions for NoV genogroups I and II. The primers and probes used to detect these viruses have been described in other reports [19 (link), 20 (link)].
5
TSPO Knockdown in RAW 264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RAW 264.7 cells were transfected with either control siRNA (ON-TARGETplus Non-targeting Pool; GE Dharmacon) or TSPO siRNA (SMARTpool: ON-TARGETplus TSPO siRNA; GE Dharmacon). Briefly, the cells were plated overnight and transfected with control or TSPO siRNA using HiPerFect Transfection Reagent (QIAGEN) according to manufacturer’s instructions. Target gene knockdown was verified 48-h post-transfection by qRT-PCR. To accomplish this, total RNA was isolated (SV RNA Isolation System, Promega), and quantitative RT-PCR was performed on a Cepheid SmartCycler II using a SuperScript III Platinum SYBR Green One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). Primers were as follows: TSPO (5′AGAAACCCTCTTGGCATCCG3′(F), 5′ GCCATACCCCATGGCTGAATA 3′(R) and RPS3: (FP 5′-AATGAACCGAAGCACACCATA-3′; RP 5′-ATCAGAGAGTTGACCGCAGTT-3′). Product specificity was confirmed by melting curve analysis and gene expression levels were quantified using a cDNA standard curve. Data were normalized to RPS3, a housekeeping gene that was unaffected by the experimental conditions.
6
Hepatitis C Diagnosis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Patients with CHC were diagnosed by elevated levels of ALT and higher titers of anti-HCV, established by third-generation enzyme immunoassay (AxSym HCV 3.0; Abbott Laboratories, Abbott Park, IL, USA). Also, HCV RNA as a measure of diagnosis was reported qualitatively using a nested polymerase chain-reaction Qiagen RNA-extraction kit (Thermo Fisher Scientific, Waltham, MA, USA) and quantitatively using Smart Cycler II real-time polymerase chain reaction (Cepheid, Sunnyvale, CA, USA) with HCV RNA-quantification kits (Sacace Biotechnologies, Como, Italy) for estimation of HCV RNA-positive subjects, as previously described.37 (link),38 (link) In addition, reverse hybridization was performed to identify HCV genotypes using a line-probe assay (Inno-LiPA HCV II kit; Innogenetics, Ghent, Belgium).39 (link)
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated (SV RNA Isolation kit, Promega, Madison, WI, USA) and qRT-PCR was performed on a Cepheid SmartCycler II (Cepheid, Sunnyvale, CA, USA) using a Superscript III Platinum SYBR Green One-Step qRT-PCR kit (Invitrogen, Carlsbad, CA, USA), as per our laboratory [34 (link), 39 (link), 41 –43 (link)]. Product specificity was confirmed by melting curve analysis and visualization of a single, appropriately sized band on a 2% agarose gel. Gene expression levels were quantified using a cDNA standard curve and data was normalized to RPS3, a housekeeping gene that is unaffected by the experimental manipulations. Data is expressed as fold change versus sham.
8
Quantifying c-Src Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells or tissues were harvested with Trizol Reagent (Invitrogen, Carlsbad, CA, USA), and total RNA was isolated according to the manufacturer's instructions. cDNA synthesis was performed using the Superscript III RT-PCR kit (Invitrogen). Real-time PCR was carried out using a Cepheid SmartCycler II (Sunnyvale, CA, USA) with gene-specific real-time PCR primers. Results were normalized to GAPDH transcript levels, and the difference in fold expression was calculated using the ΔΔ CT method. The primers used for c-Src were as follows: sense, 5′-CTCTTCAGAGCCCTTGCTCA-3′ and antisense, 5′-ATTCACCCTCCCCCAAGGAA-3′. The length of the PCR products was 193 bp.
9
Optimizing Molecular Diagnostic Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Initial preparation of the sample sets included testing all materials at their final target concentration in triplicate to ensure that the target concentration was achieved and that reproducibility was adequate. Avian molecular samples were internally calibrated with two different real-time PCR instruments each with RT-PCR reagents from a different manufacturer (7500 FAST [Applied Biosystems, Foster City, CA] with the Ambion AgPath kit [Life Technologies, Waltham, MA] and the Smart Cycler II [Cepheid, Inc., Carlsbad, CA] with the OneStep RT-PCR kit [Qiagen, Inc, Valencia, CA]). Both variations used the USDA M gene primers and probes [7 (link)]. After the second round of testing it was determined that use of a second test did not provide better information and was discontinued; only the 7500 FAST based test was used subsequently. Mammalian molecular samples were only tested with the 7500 FAST and Ambion AgPath kit, using USDA M gene primers and probes [7 (link)].
The test materials were monitored for deterioration by running material that was retained at 1–2 week intervals until all results were returned. Molecular sample sets were stored at both the recommended 4°C and at -20°C, ambient temperature and 37°C to evaluate the effect of different temperatures on sample stability.
The test materials were monitored for deterioration by running material that was retained at 1–2 week intervals until all results were returned. Molecular sample sets were stored at both the recommended 4°C and at -20°C, ambient temperature and 37°C to evaluate the effect of different temperatures on sample stability.
10
Evaluating PCR Inhibition in Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To control for potential PCR inhibitors in genomic DNA extracts, universal eukaryotic primers, F-573 and R-1200 (S1 Table ) [26 (link)] were used to amplify a fragment of DNA from the molluscan 18S rRNA gene of each sample. The PCR protocol used was identical to that described for the conventional PCR, although primers F-573 and R-1200 were used instead of AngioF1 and AngioR1. This was performed to rule out false negatives resulting from PCR inhibition. As an additional measure to rule out inhibition in the Real-Time PCR assay, 10 μL of each DNA sample was spiked with 2 μL of A. cantonensis DNA and then analysed on the Smart Cycler II (Cepheid), using the Real-Time PCR protocol described. Samples suspected of containing inhibitors were diluted with PCR water and then retested.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!