Bleomycin (BLM) was purchased from Nippon Kayaku (Tokyo, Japan). The P-FAK inhibitor defactinib (a specific FAK phosphorylation inhibitor) were purchased from Medchemexpress (no. HY-12289). Mouse and human recombinant OPN were purchased from R&D Systems (no. 441-OP-050, no. 1433-OP-050). Mouse biotin-OPN was synthesized by Medchemexpress. The LV-OPN-siRNA was synthesized by GENECHEM (Shanghai, China). Antibodies used in this study were listed in Additional file 3 : Table S1.
Defactinib
Manufactured by MedChemExpress
Sourced in United States
Defactinib is a small molecule compound that inhibits the protein FAK (Focal Adhesion Kinase). It is a lab equipment product offered by MedChemExpress for research purposes.
Automatically generated - may contain errors
Lab products found in correlation
Bleomycin, by Nippon Kayaku (1 mentions)
Capmatinib, by MedChemExpress (1 mentions)
Sch772984, by MedChemExpress (1 mentions)
Sp600125, by MedChemExpress (1 mentions)
Ly294002, by MedChemExpress (1 mentions)
Sb203580, by MedChemExpress (1 mentions)
Pcdna3, by Takara Bio (1 mentions)
Be0039, by BioXCell (1 mentions)
Plvx puro, by Takara Bio (1 mentions)
Flag tag (flag), by Merck Group (1 mentions)
Plko 1 puro vector, by Addgene (1 mentions)
β actin, by Merck Group (1 mentions)
Capivasertib, by MedChemExpress (1 mentions)
Docetaxel, by MedChemExpress (1 mentions)
Pan akt, by Cell Signaling Technology (1 mentions)
Ab189490, by Abcam (1 mentions)
Mk2206, by MedChemExpress (1 mentions)
P akt ser473, by Cell Signaling Technology (1 mentions)
F3879, by Merck Group (1 mentions)
Taselisib, by MedChemExpress (1 mentions)
6 protocols using defactinib
1
Inhibition of Focal Adhesion Kinase
2
Combinatorial Treatment of HCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PI3K inhibitor LY294002, ERK1/2 inhibitor SCH772984, JNK inhibitor SP600125, p38 inhibitor SB203580, capmatinib and defactinib were purchased from MedChemExpress. The agents were used under the standard protocols. The HCC cells were pretreated with PI3K inhibitor LY294002 (10 μM), ERK1/2 inhibitor SCH772984 (10 μM), JNK inhibitor SP600125 (10 μM), or p38 inhibitor SB203580 (10 μM) for 1 h. defactinib was orally administered at a dose of 25 mg/kg twice a day, capmatinib was orally administered at a dose of 10 mg/kg/day. The treatment began on the seventh day after the establishment of the animal model and lasted eight weeks.
3
Gene Overexpression and Knockdown Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human SRGN and CD44 were constructed into the pLVX-puro and pCDNA3.1 vectors (Clontech), respectively, for overexpression. The annealed sense and antisense shRNA oligonucleotides were cloned into the pLKO.1-puro vector (Addgene) for knockdown of human SRGN with the following target sequences: CCAGGACTTGAATCGTATCTT (shSRGN#2), ACATGGATTAGAAGAGGATTT (shSRGN#5). The annealed sense and antisense sgRNA oligonucleotides were cloned into pX458 vector for knockout of murine Cd44 with the following target sequences: AATGTAACCTGCCGCTACGC (sgCd44#1), GGGAGGTGTTGGACGTGACG (sgCd44#3). The antibodies used for Western blotting, immunoprecipitation and immunohistochemistry were as follows: β-ACTIN (A2228, Sigma), Flag (F1804, Sigma), SRGN (sc-374657, Santa Cruz), CD44 (37259, CST), His (12698, CST), FAK (A11531, Abclonal), phosphor-FAK (AP0302, Abclonal), H3.3G34W (RM263, RevMAb). The CD44 neutralizing antibodies were obtained from Thermo Fisher Scientific (14-0441-82) for in vitro treatment and from Bio X Cell (BE0039) for in vivo treatment. The human SRGN recombinant protein was from Sino Biological (13648-H08H). The murine RANKL recombinant protein (Peprotech, 315-11) and the murine M-CSF recombinant protein (Peprotech, 315-02) were used in this study. The FAK inhibitor Defactinib for in vitro assay (2 μM) was obtained from MedChemExpress (HY-12289).
4
Investigating Inflammatory Markers and Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antibodies used for immunoblotting included: mouse monoclonal antibody against GAPDH (RM2002; Beijing Ray, Beijing, China); rabbit antibodies against Fg (ab189490; Abcam, Cambridge, MA), pan-Akt (4691; Cell Signaling Technology, Danvers, MA), p-Akt (Ser473) (4060; Cell Signaling Technology), and goat anti-mouse (R3001, Beijing Ray) or goat anti-rabbit (R3002, Beijing Ray) horseradish peroxidase–conjugated secondary antibody.
The antibodies used for immunohistochemical staining included: CD11b (ab133357; Abcam), S100A9 (73425; Cell Signaling Technology), MPO (ab9535; Abcam), F4/80 (ab111101; Abcam), and CD31 (3528; Cell Signaling Technology).
Other reagents included DSS (36,000–50,000 kD; MP Biomedicals, Santa Ana, CA), Evans blue (E2129; Sigma-Aldrich, St. Louis, MO), Fg (F3879; Sigma-Aldrich), GPRP acetate, LY294002, taselisib, capivasertib, MK 2206, defactinib, Y15, saracatinib, WH-4-023, L-NIO, L-NMMA, ML-7, MLCK inhibitor, docetaxel, Jasplakinolide, and Cytochalasin D (MedChemExpress, Monmouth Junction, NJ).
The antibodies used for immunohistochemical staining included: CD11b (ab133357; Abcam), S100A9 (73425; Cell Signaling Technology), MPO (ab9535; Abcam), F4/80 (ab111101; Abcam), and CD31 (3528; Cell Signaling Technology).
Other reagents included DSS (36,000–50,000 kD; MP Biomedicals, Santa Ana, CA), Evans blue (E2129; Sigma-Aldrich, St. Louis, MO), Fg (F3879; Sigma-Aldrich), GPRP acetate, LY294002, taselisib, capivasertib, MK 2206, defactinib, Y15, saracatinib, WH-4-023, L-NIO, L-NMMA, ML-7, MLCK inhibitor, docetaxel, Jasplakinolide, and Cytochalasin D (MedChemExpress, Monmouth Junction, NJ).
5
Protein Immobilization on Silicon Wafers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The single side polished p-type silicon wafers
(1–10 Ω̇cm resistivity) were purchased from Hefei
Kejing Materials Technology Co. Ltd., China. The BSA was obtained
from Sinopharm Chemical Reagent Co. Ltd., China. Sulfo-NHS and EDC
were bought from Shanghai Macklin Biochemical Co., Ltd., China. Rhodamine
110 chloride was purchased from Sigma-Aldrich Chemicals Reagent Co.
Ltd., USA. The primary antibodies used were anti-STAT1-α, anti-NF-κB,
anti-C-JUN, anti-IRF5 purchased from Abcam, U.K. Goat anti-rabbit
IgG(H&L)-HRP and anti-tubulin-β were purchased from Bioworld,
China. Dulbecco’s modified Eagle’s medium (DMEM), MTT,
JC-1, DAPI, LysoTracker red probes, and MitoTracker organelle probes
were all obtained from KeyGEN Biotechnology Co. Ltd., China. Defactinib
(an inhibitor of IRF5), JSH-23 (an inhibitor of NF-κB), and
SP600125 (an inhibitor of AP-1) were obtained from MedChemExpress,
USA. Deionized (DI) water (≥18 MΩ̇cm resistivity,
Millipore) was used in the experiments.
(1–10 Ω̇cm resistivity) were purchased from Hefei
Kejing Materials Technology Co. Ltd., China. The BSA was obtained
from Sinopharm Chemical Reagent Co. Ltd., China. Sulfo-NHS and EDC
were bought from Shanghai Macklin Biochemical Co., Ltd., China. Rhodamine
110 chloride was purchased from Sigma-Aldrich Chemicals Reagent Co.
Ltd., USA. The primary antibodies used were anti-STAT1-α, anti-NF-κB,
anti-C-JUN, anti-IRF5 purchased from Abcam, U.K. Goat anti-rabbit
IgG(H&L)-HRP and anti-tubulin-β were purchased from Bioworld,
China. Dulbecco’s modified Eagle’s medium (DMEM), MTT,
JC-1, DAPI, LysoTracker red probes, and MitoTracker organelle probes
were all obtained from KeyGEN Biotechnology Co. Ltd., China. Defactinib
(an inhibitor of IRF5), JSH-23 (an inhibitor of NF-κB), and
SP600125 (an inhibitor of AP-1) were obtained from MedChemExpress,
USA. Deionized (DI) water (≥18 MΩ̇cm resistivity,
Millipore) was used in the experiments.
6
Xenograft Tumor Model in BALB/C Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For animal experiments, female, 4-to 6-week-old BALB/C nude mice were purchased from Beijing HFK Bioscience Co., Ltd. (Beijing, China), and were maintained according to protocols approved by the Ethical Committee on Animal Experiments of the Animal Care Committee of Wuhan University (S07921060J). For co-implanted assay, the sphere forming cells and fibroblasts were resuspended in a PBS/Matrigel (BD Biosciences) mixture (1:1 volume), which were then injected in the into the subcutaneous tissue of mouse flanks using 27-gauge needles. For drug administration assay, the Losartan, Defactinib, and DZNep, all purchased from MedChemExpress (MCE, USA), were injected intraperitoneally into the BALB/C nude mice bearing with co-implanted xenograft.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!