The largest database of trusted experimental protocols

Antibodies against

Manufactured by Santa Cruz Biotechnology
Sourced in United States, Canada

Antibodies against are a type of laboratory reagent used to identify and detect specific proteins or molecules in biological samples. These antibodies are produced by the immune system and can be isolated and used for various research and diagnostic applications. The core function of antibodies against is to bind to and recognize their target analyte, enabling researchers to study its presence, distribution, and interactions within a sample.

Automatically generated - may contain errors

63 protocols using antibodies against

1

Western Blot Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were lysed using sodium dodecyl sulfate buffer containing proteinase inhibitors (Roche). Equal amounts of protein (50 μg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Bio-Rad Laboratories, Shanghai, China). The membranes were blocked and incubated with Antibodies against GAPDH (dilution 1:200, Cat. no. sc-47724), IL-6 (1:200, Cat. no. sc-65327), p53 (1:200, Cat. no. sc-47698) and IL-17R (1:100, Cat. no. sc-376374) overnight at 4°C. Antibodies against GAPDH, IL-6, p53 and IL-17R were purchased from Santa Cruz Biotechnology. The membranes were then incubated with horseradish peroxidase-labeled secondary antibody (1:500, Cat. no. sc-2031) (Santa Cruz Biotechnology). The protein bands were visualized using an enhanced chemiluminescence reagent.
+ Open protocol
+ Expand
2

Arctigenin Mechanism of Action

Check if the same lab product or an alternative is used in the 5 most similar protocols
Arctigenin was purchased from Enzo Life Sciences (Farmingdale, NY, USA). The chemical structure of arctigenin is as shown in Fig. 1A. All reagents used for cell culture were purchased from Thermo Scientific (Fremont, CA, USA). Antibodies against HO-1, Nrf-2, c-Jun, and lamin A were purchased from Santa Cruz Biotechnology (Dallas, Texas, USA). Antibodies against phospho- or total forms of ERK, JNK, p38, and AKT were obtained from Cell Signaling Technology (Danvers, MA, USA). All reagent used for RT-PCR were purchased from Promega (Madison, WI, USA).
+ Open protocol
+ Expand
3

Sirtinol-mediated Regulation of FoxO3a

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sirtinol was purchased from Calbiochem (Darmstadt, Germany). Sirtinol was dissolved in 100% DMSO at concentration of 10 mM and stored at −20°C until use. The following compounds were obtained from Gibco BRL (Maryland, USA): Dulbecco's modified eagle medium (DMEM), Ham's F-12 Nutrient Mixture (F-12) fetal bovine serum (FBS), trypan blue, penicillin G, and streptomycin. Dimethyl sulfoxide (DMSO), ribonuclease A (RNase A), and propidium iodide (PI) were purchased from Sigma-Aldrich (Missouri, USA). Antibodies against FoxO3a were obtained from Epitomics (California, USA). Annexin V-FITC staining kit was purchased from Strong Biotech (Taipei, Taiwan). Antibodies against phospho-Akt, β-catenin, Sirt1, and β-actin were purchased from Santa Cruz Biotechnology (California, USA). Anti-mouse and anti-rabbit IgG peroxidase-conjugated secondary antibodies were purchased from Pierce (Illinois, USA). The anti-rabbit Rhodamine-conjugated antibody was purchased from Abcam (Cambridge, UK).
+ Open protocol
+ Expand
4

Comprehensive Biochemical Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Folin–Ciocalteu reagent, silver nitrate and gold chloride solution, as well as Bradford reagent and 2-thiobarbituric acid were purchased from Sigma-Aldrich Chemicals GmbH (Darmstadt, Germany). Kits for capase-3 and capase-8 determinations were purchased from Elabscience (Houston, TX, USA). Antibodies against p53, BCL2, BAX, NFkB, pNFkB proteins and GAPDH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against Ki-67 were purchased from Invitrogen (Rockford, IL, USA) and those against PCNA and MAPK were purchased from Cell Signaling Technology (Danvers, MA, USA). Propidium iodide and Annexin V-fluorescein isothiocyanate were purchased from BD Pharmingen Biosciences (San Jose, CA, USA). The CellTiter 96® cell proliferation assay was purchased from Promega Corporation (Madison, WI, USA). All reagents used were of high purity.
+ Open protocol
+ Expand
5

Antibody generation and siRNA targeting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Affinity-purified Antibodies against total and Ser886 and Ser999 phospho-sites of EPRS were generated as described7 (link),31 (link). Antibody against phospho-Ser was from Meridian Life Science. Antibodies specific for the C-terminus of S6K1 and N-terminus of S6K2 were purchased from Abcam and LifeSpan, respectively. Antibodies against PKA, DMPK, PKN, GAPDH, caveolin1, CD36/FAT, GLUT4, His-tag, β-actin and FATP1, FATP3, and FATP4 were from Santa Cruz. Antibody specific for FABP4 and FABP5 were from R&D and for FABPpm/GOT2 was from GeneTex. All other antibodies and rapamycin were from Cell Signaling. SignalSilence siRNAs targeting RSK1, AKT and S6K1 were from Cell Signaling, and those targeting raptor and rictor were from Santa Cruz. The 3′UTR-specific duplex siRNAs, UGAUACGAAGAUCUUCUCAG and GCCUAAAUUAACAGUGGAA, targeting mouse EPRS were from Origene. Smart pool siRNA targeting the coding sequence of mouse FATP1 (SLC27a1) was from Dharmacon and 3′UTR-specific trilencer siRNA targeting human S6K1 was from Origene.
+ Open protocol
+ Expand
6

Western Blot Analysis of Iron Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot was performed as described (Zhang et al. 2014 (link)). Antibodies against p53, p21, IRP2, and TfR1 were purchased from Santa Cruz Biotechnology. Anti-mouse p53 (1C12) was purchased from Cell Signaling Technology. Antibodies against FDXR, FDX1, FDX2, IRP1, and FTH1 were purchased from Abcam. Anti-HA was purchased from Covance. Anti-actin and HRP-conjugated secondary Antibodies against rabbit or mouse IgG were purchased from Bio-Rad. The immunoreactive bands were visualized by enhanced chemoluminescence (Thermo Fisher Scientific, Inc.) and quantified by densitometry with the BioSpectrum 810 imaging system (UVP LLC).
+ Open protocol
+ Expand
7

Antibody Characterization of ATPase Subunits

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chemicals of the highest purity and culture media were purchased from Sigma and Invitrogen. Akt and phosphorylated (Ser473) Akt anitbodies were purchased from Cell Signaling Technology (Danvers, MA). Antibodies against ERK 1/2, phosphorylated ERK 1/2, α2 subunit of Na+/K+-ATPase, PI3K p110α, PI3K p110γ, PI3K p85α, Src, goat anti-mouse IgG-horseradish peroxidase, and goat anti-rabbit IgG-horseradish peroxidase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibody against Na+/K+-ATPase α1 subunit (α6F) was purchased from Developmental Studies Hybridoma Bank (Iowa City, IA). Na+/K+-ATPase α3 subunit antibodies (MA3-915) were purchased from Pierce Biotechnology (Rockford, IL).
+ Open protocol
+ Expand
8

Protein and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot and real-time PCR analysis were performed as described previously [17 (link)]. Antibodies against NFATc1 and actin were purchased from Santa Cruz Biotechnology (CA, USA). Primers (Table 1) were chosen with the online Primer3 design program [32 (link)].
+ Open protocol
+ Expand
9

Osteoclastogenesis Assay with M-CSF and RANKL

Check if the same lab product or an alternative is used in the 5 most similar protocols
Penicillin, streptomycin, cell culture medium, and fetal bovine serum (FBS) were purchased from Invitrogen Life Technologies. Mouse soluble macrophage-colony stimulating factor (M-CSF) and RANKL were purchased from R&D Systems. The CCK-8 assay kit was purchased from Dojindo Molecular Technologies. Antibodies against nuclear factor of activated T cells (NFAT)c1, c-Fos, and actin were purchased from Santa Cruz Biotechnology and Antibodies against MAP kinases from Cell Signaling Technology. Matairesinol was purchased from Sigma-Aldrich and dissolved in DMSO (dimethylsulfoxide; Sigma-Aldrich).
+ Open protocol
+ Expand
10

Osteoclastogenesis Signaling Pathway Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies against phospho-Jun N-terminal kinase (p-JNK), JNK, phospho-p38, p38, phosphor-extracellular signal-regulated kinase (p-ERK), ERK, IκBα, and β-actin were obtained from Cell Signaling Technology (Danvers, MA, USA). Antibodies against c-Fos and NFATc1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Recombinant macrophage colony-stimulating factor (M-CSF) and RANKL were obtained as previously described [11 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!