Sybr premix extaq mix

Total RNA was isolated with Trizol Reagent (Invitrogen #15596-026), digested with DNase I (Takara #2270A) and reverse transcribed to cDNA with Superscript-III reverse transcriptase (Invitrogen # 18080-044) according to the user manual. qPCR analyses were performed using SYBR Premix Ex Taq Mix (Takara # RR420A) and ABI7500 according to the manufacturer’s instructions. The relative expression was calculated according the comparative C_T methods (Schmittgen and Livak, 2008 (link)). CsACTIN2 (Csa6M484600) and CsTUB1 (Csa4M000580) for cucumber and UBIQUITIN (AT4G05320) for Arabidopsis were used as reference. Primers were designed using Primer Primier 5 and are listed in Supplementary Table S2. For each sample, at least three biological replicates were analyzed and for each PCR, at least three technical replicates were used to calculate the C_T value.

Total RNA was extracted from the brain using TRIzol reagent, following the manufacturer’s protocol. Real-time PCR of 2-μl cDNA was used to determine the expression levels of Hes1, Hes5, Hey1, and Hey2 on an ABI 7500 Real-time PCR System with SYBR Premix Ex Taq mix (TaKaRa) in 20-μl reaction volumes. Relative levels of transcripts were calculated by normalizing to β-actin and wild-type (WT) mice (the mean expression of the WT mice was set to 100%) using the 2 − △△CT method. The primer sequences used are listed in Table 1.Table 1

Primers used in real-time RT-PCR analysis

Primer	Sequence (5′–3′)	Product length
Hes1-F	TCAACACGACACCGGACAAAC	155 bp
Hes1-R	ATGCCGGGAGCTATCTTTCTT
Hes5-F	CAGCCCGTAGAGGACTTTCTT	103 bp
Hes5-R	GCAGTTCCGCCTTCACAA
Hey1-F	CCGACGAGACCGAATCAATAAC	125 bp
Hey1-R	TCAGGTGATCCACAGTCATCTG
Hey2-F	AAAAGGCGTCGGGATCGAATA	177 bp
Hey2-R	AGCATGGGCATCAAAGTAGCC
β-actin-F	TACGCCAACACAGTGCTGTCTG	200 bp
β-actin-R	CTGCTTGCTGATCCACATCTGC

Cells grown to OD₆₀₀ 0.3 were treated with 1.0 mM diamide for 0, 20, 60, 90 and 120 min prior to harvest of total RNA (RNeasy Mini Kit, Cat# 74104, Qiagen). RNA-seq library construction and sequencing were carried out by BGI-Tech (Shenzhen, China); expression level calculated as RPKM was compared between diamide treated samples and untreated samples. For qRT-PCR, cells grown to OD₆₀₀ 0.3 were treated with 1.5 mM diamide for 0–5 h before harvesting total RNA. Reverse transcription was conducted using PrimeScript™ RT reagent Kit (Cat# RR047A, TaKaRa); qRT-PCR with SYBR Premix Ex Taq™ Mix (Cat# DRR820A, TaKaRa) on LightCycler^®480 II (Roche). Relative expression level normalized to act1⁺ (SPBC32H8.12c) of WT cells at 0 h.

RNA from sorted thymic ECs was extracted using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. The quality and quantity of the total RNA was assessed using a Nanodrop spectrophotometer (ND 2000C; Thermo Fisher Scientific). The total RNA was reverse-transcribed using a RevertAid First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer's instructions. The primers used are listed in Supplementary Table 5. Quantitative real-time PCR was performed using SYBR Premix Ex Taq mix (Takara) and the reactions were run on a real-time PCR system (7500, Applied Biosystems). The relative messenger RNA expression levels were calculated using 7500 software v2.0.6 (Applied Biosystems).

TLR4 mRNA expression was detected by reverse transcription polymerase chain reaction (RT-PCR). Cells were treated with various doses of ginkgolide B for 1 h, and high glucose was added for another 8 h. Total RNAs were isolated for HUVEC culturing using Trizol reagent (Thermo Fisher Scientific, Waltham, USA). RT-PCR was performed using SYBR Premix Ex Taq mix (Takara, Dalian, China). The primers were the following: forward (5′-CCGCTTCCTGGTCTTATCAT) and reverse (5′-TCTGCTGCAACTCATTTCAT). After amplification, portions of the PCR mixtures were electrophoresed on a 2% agarose gel and visualized by a Bio-Rad Gel Doc 2000 device (Bio-Rad, Hercules, CA, USA).

RNA was isolated using Trizol reagent followed by cDNA preparation using superscript III (Invitrogen, USA) and oligo dT (Fermentas, Germany). Quantitative Real Time PCR (qRT-PCR) was performed using SYBR Premix Ex Taq mix (Takara Bio Inc, Japan) in Realplex2 Mastercycler (Eppendorf, Germany). The average threshold CT values were determined and normalized to β-actin mRNA levels which were used as an internal control. The fold difference was calculated using the formula 2^−(ΔΔCT).

Total RNA was extracted from the skin tissues using TRIzol reagent (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. The total RNA (1 μg) was reverse transcribed at 37°C using PrimeScript^™ RT Enzyme (Takara, Shiga, Japan). Real-time RT-PCR was performed using a real-time PCR detection system (Takara Bio, Madison, WI, USA), and expression of the following genes was detected in the AA (-), AA (+), and AJ groups: tyrosinase (Tyr), tyrosinase related protein-1 (Tyrp1), dopachrome tautomerase (Dct), Tnf-α, endothelin 1 (Edn1), and cyclin D1 (Ccnd1). The final mixture for RT-PCR consisted of 1× SYBR Premix Ex Taq Mix (Takara), 0.4 μM of primers (forward and reverse), and cDNA. The primer sequences are provided in Table 1. The PCR amplification consisted of 40 cycles (95°C for 5 s and 60°C for 30 s) after an initial denaturation step (95°C for 10 s). The mRNA expression levels were evaluated relative to the level of ribosomal protein, large, P1 (Rplp1), and the mRNA levels of the AA (+) group were designated as 1.0.