Total RNA was isolated from stably transfected OE33/DKK3 and OE33/Vector cells using QIAzol (Qiagen) and purified with miRNeasy spin columns (Qiagen). RNA quality was confirmed by 1% agarose gel electrophoresis and A260:280 by NanoDrop 2000 spectrophotometer ratios. RNA quality was reassessed with the Agilent Bioanalyzer (Agilent Technologies) after double-stranded cDNA and cRNA synthesis. Hybridization and normalization of the Human Gene 2.1 ST Gene Chip data (Affymetrix) were performed by the University of Michigan Cancer Center Microarray Core. A summary statistic was calculated for the eleven probe pairs for each gene with the robust multichip average (RMA) method (14) using the Affymetrix library of Bioconductor (www.bioconductor.org ). Expression values for OE33/DKK3 were compared with OE33/Vector. Pathway analysis was performed using DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.gov ). Results were confirmed using real-time PCR.
Mirneasy spin column
Manufactured by Qiagen
Sourced in United States
The MiRNeasy spin columns are a lab equipment product designed for the isolation and purification of microRNA (miRNA) and other small RNA molecules from various sample types. The core function of these spin columns is to provide a reliable and efficient method for extracting high-quality miRNA from a wide range of biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Qiazol, by Qiagen (2 mentions)
2100 bioanalyzer, by Agilent Technologies (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Agilent bioanalyzer, by Agilent Technologies (1 mentions)
Human gene st 2.1 arrays, by Thermo Fisher Scientific (1 mentions)
Ambion wt expression kit, by Thermo Fisher Scientific (1 mentions)
Bioanalyzer, by Agilent Technologies (1 mentions)
Mytaq dna polymerase, by Meridian Bioscience (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Direct zol miniprep rna purification kit, by Zymo Research (1 mentions)
Paxgene blood rna kit, by Qiagen (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green pcr kit, by Qiagen (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
10 protocols using mirneasy spin column
1
Transcriptomic Analysis of DKK3 Overexpression
2
RNA Extraction and Quantification for Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell lysates using miRNeasy spin columns (Qiagen, Valencia, CA) according to the manufacturer’s instructions, with on-column DNAse treatment to eliminate residual genomic DNA. Spectrophometric assessment (Nanodrop; Thermo Scientific, Waltham, MA) confirmed that RNA purity was adequate (260/280 ratio 2.0–2.1 in all samples). The 260/230 ratio was between 1.8 and 2.2 for 80% of samples, although lower values (0.6–1.7) were obtained in 11 samples, likely reflecting minor contamination with guanidine thiocyanate from the extraction procedure. As this measure has little correlation with efficiency of downstream analyses [18 (link)], these samples were not excluded, and did not have appreciable differences in sequence read count or quality, or PCR cycle threshold values. The RNA integrity in samples used for sequencing was confirmed to be sufficient by electrophoresis (Bioanalyzer 2100; Agilent, Santa Clara, CA), with an RNA Integrity Number between 8.4 and 9.3 in all samples. The samples were diluted to 220 ng/μL for sequencing, and to 66 ng/μL for PCR, based on fluorometric quantification (Qubit™, Thermo Fisher Scientific).
3
Transcriptomic Analysis of Esophageal Cancers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from normal esophageal squamous (NE; n=8), normal gastric (NG; n=5) epithelium and adenocarcinomas arising at both the gastro-esophageal junction (GEJAC; n=70), and within the ‘tubular’ esophagus (tEAC; n=52) using miRNeasy spin columns (Qiagen, Valencia, CA), including on-column DNAse I incubation, according to the manufacturer's instructions. RNA samples with RIN scores greater than 6.0 (Bioanalyzer; Agilent Technologies, Palo Alto, CA), were submitted to the University of Michigan Cancer Center Genomics Core for cDNA synthesis, cRNA amplification (Ambion WT Expression Kit; Life Technologies, Grand Island, NY) and hybridization to Human Gene ST 2.1 arrays (Affymetrix, Santa Clara, CA) according to the manufacturer instructions. Expression values for each gene were estimated using the robust multi-array average (RMA) method [54 (link)] in the Bioconductor package [55 (link)] and log2-transformed. Analyses were restricted to the 26,613 coding and non-coding genes for which annotation details were available, including HUGO Gene Nomenclature Committee (HGNC) approved gene symbol and Entrez Gene ID.
4
RNA Extraction and Quantification Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed with the Direct‐zol Miniprep RNA Purification Kit (Zymo Research) with on‐column DNase treatment, according to the manufacturer's instructions. For RNA pull‐down and RIP experiments, the RNA was extracted using QIAzol reagent and miRNEasy spin columns (QIAGEN), according to the manufacturer's specifications.
For routine experiments, total RNA was retro‐transcribed with PrimeScript™ RT Reagent Kit (Takara) according to the manufacturer's instructions while, for low RNA input experiments (RNA pull‐down and RIP), the Superscript VILO cDNA Synthesis Kit was used (Life Technologies). Samples were then analyzed by qPCR using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) or by semi‐quantitative RT–PCR using MyTaq™ DNA polymerase (Bioline). The oligonucleotide sequences are listed inTable EV4 .
For routine experiments, total RNA was retro‐transcribed with PrimeScript™ RT Reagent Kit (Takara) according to the manufacturer's instructions while, for low RNA input experiments (RNA pull‐down and RIP), the Superscript VILO cDNA Synthesis Kit was used (Life Technologies). Samples were then analyzed by qPCR using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) or by semi‐quantitative RT–PCR using MyTaq™ DNA polymerase (Bioline). The oligonucleotide sequences are listed in
5
RNA Isolation and Reverse Transcription from Diverse Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from NPC cell pellets and EV concentrate from NPC, plasma, and urine by adding QIAzol (Qiagen); samples were then mixed with one‐fifth volume of chloroform with brief centrifugation at 12,000g to allow for phase separation. The aqueous phase was processed using miRNeasy spin columns (Qiagen) with on‐column DNase digestion as recommended. RNA was extracted from whole blood using the PAXgene Blood RNA Kit according to the manufacturer's protocol (Qiagen). The resulting RNA samples were quantified by Nanodrop (ThermoFischer Scientific) and Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). RNA from NPCs (40 ng), NPC EVs (2–10 ng), plasma EVs (0.5–3.5 ng), urine EVs (0.5–3.5 ng), and whole blood (40 ng) were reverse transcribed using the SuperScript VILO cDNA Synthesis Kit (ThermoFisher Scientific).
6
Sensory Region RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each sensory region (cristae ampullares, utricle, and cochlea) from an individual POC sample aged 10–17 WG, RNA was extracted using QIAGEN miRNeasy Kit (QIAGEN, Australia) according to manufacturer’s instructions. Briefly, sensory regions were homogenized in 700 μl QIAzol lysis reagent and incubated at room temperature for 5 min. Samples were loaded into QIAGEN miRNeasy spin columns and total and small RNA were isolated. RNA quality and quantity were determined using Nanospectrophotometry.
7
Quantification of mRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the quantification of mRNAs, total RNA was purified using RNeasy Mini Kit (Qiagen) and reverse transcribed to cDNA using QuantiTect Reverse Transcription Kit (Qiagen). Equal amounts of cDNA were taken for a subsequent real-time qRT-PCR using QuantiTect SYBR Green PCR kit (Qiagen). The relative quantity of mRNA was determined by the comparative threshold cycle method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression for normalization. All the primers used were listed in Table S2 .
For miRNA analysis, total RNA inclusive of the small RNA fraction was purified using miRNeasy spin columns (Qiagen) and reverse transcribed using TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocol. The TaqMan® MicroRNA Assays (Applied Biosystems) used for miRNA quantification were listed inTable S3 . Expression levels of RNU6B were used for normalization.
The real-time qRT-PCR was run on a 7900HT Fast Real-Time PCR System (Applied Biosystems) and the data were analyzed using the 2−ΔΔCt method.
For miRNA analysis, total RNA inclusive of the small RNA fraction was purified using miRNeasy spin columns (Qiagen) and reverse transcribed using TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocol. The TaqMan® MicroRNA Assays (Applied Biosystems) used for miRNA quantification were listed in
The real-time qRT-PCR was run on a 7900HT Fast Real-Time PCR System (Applied Biosystems) and the data were analyzed using the 2−ΔΔCt method.
8
Quantification of Circular RNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen). The obtained RNA samples were quantified on a Nanodrop platform (Thermo Scientific Fisher) and purified using miRNEasy spin columns (QIAGEN). To detect hsa_circ_0001806 expression, the RNA extract was incubated with RNase R (Epicenter, Madison) before RNA purification. Then, RNA was reverse‐transcribed using HiScript II Q RT SuperMix for qPCR (Vazyme). qRT‐PCR was performed using the AceQ SYBR Green PCR Master Mix (Vazyme, Nanjing, China) on the ABI 7900 HT sequence detection system (Applied Biosystems). The circRNA and mRNA levels were normalized to U6 and GAPDH levels. Triplicates of each experiment were performed. The primer sequences used in this study are provided: hsa_circ_0001806, forward: 5'‐CCATCCCATCAGTTCATCCT‐3' and reverse: 5'‐TTCACCTCCAAAGAGCATCC‐3'; Hexokinase 2 (HK2), forward: 5'‐GAGCCACCACTCACCCTACT‐3' and reverse, 5'‐CCAGGCATTCGGCAATGTG‐3'; GAPDH, forward: 5'‐TGTGGGCATCAATGGATTTGG‐3' and reverse: 5'‐ACACCATGTATTCCGGGTCAAT‐3'; miR‐125b, forward: 5′‐TCCCTGAGACCCTAACTTGTGA‐3′ and reverse: 5′‐AGTCTCAGGGTCCGAGGTATTC‐3′; U6, forward: 5′‐TGCGGGTGCTCGCTTCGGCAGC‐3′ and reverse: 5′‐CCAGTGCAGGGTCCGAGGT‐3′. The final quantization of target genes was performed using 2−ΔΔCt method.
9
Total RNA Extraction from Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from harvested cells using TRIzol (Invitrogen). Following the addition of chloroform and centrifugation, the aqueous phase was mixed with an equal volume of 100% ethanol, applied to a miRNeasy spin column (Qiagen, Valencia, CA, United States) and processed according to the manufacturer’s protocol. The extraction procedure included on-column DNase I digestion using the RNase-Free DNase Set (Qiagen) to remove contaminating genomic DNA. RNA was quantified by absorbance at 260 and 280 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher, Hudson, NH, United States).
10
Extraction of Total RNA Including Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including small RNAs with $18 nucleotides, was extracted from exposed cells using a modified QIAGEN’s miRNeasy protocol. Briefly, the cells stored in TRIzol were allowed to thaw at room temperature and were homogenized using a QIAshredder. The homogenate was incubated at room temperature for five minutes, after which 200 µL of chloroform was added and the mixture was again incubated at room temperature for three minutes, followed by centrifugation at 12,000 × g for 15 minutes at 4 °C. The aqueous phase was transferred to a new tube containing 750 µL of 100% molecular grade ethanol and mixed thoroughly. The sample was then added to a QIAGEN’s miRNeasy spin column, and the remaining steps were followed as per the manufacturer’s instructions (QIAGEN).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!