Taqman drug metabolism genotyping assay

DNA was extracted from the buccal swab samples using the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions.
Genotyping of CYP3A4 (−392 G>A, rs2740574), CYP3A5 (6986A>G, rs776746), CYP2C9 (430 C>T, rs1799853, and 1075A>T, rs1057910), and CYP2C19 (681 G>A, rs4244285 and −806 C>T, rs12248560) was performed by TaqMan^® Drug Metabolism Genotyping Assays (Thermo Fisher Scientific, USA) on ViiA Real-Time PCR System (Applied Biosystems™, Foster City, CA, USA) according to manufacturer’s protocol.
CYP1A1 (1759A>G, rs4646903) genotypes were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), using the MspI restriction enzyme (New England Biolabs, Hitchin, United Kingdom), as previously described (Feldman et al., 2009 (link)).

Following the manufacturer’s instructions, we used whole blood collected in EDTA-coated vacutainers for DNA extraction. Genomic DNA was extracted using the QIAmp DNA Blood Mini Kit (Qiagen, Hilden, Germany). A Nanophotometer Implen P300 spectrophotometer was used to measure the concentration and purity of DNA samples.
The recipients were genotyped for CYP3A4*1.001 (rs2740574, T = CYP3A4*1, C = CYP3A4*1.001), CYP3A4*22 (rs35599367, G = CYP3A4*1, A = CYP3A4*22), and CYP3A5*3 (rs776746, T = CYP3A5*1, C = CYP3A5*3) alleles using TaqMan^® Drug Metabolism Genotyping Assays (Life Technologies Corporation, Pleasanton, CA, USA). SNP genotyping was performed on the Applied Biosystems 7300 Real-Time PCR System (7300 System v.1.4.0). The final volume for 96 reactions was 25 µL, consisting of 12.5 µL TaqMan Universal PCR Master Mix, 1.25 µL TaqMan Genotyping Assay Mix, and 11.25 µL DNA. The PCR program consisted of an initial denaturation step of 10 min at 95 °C and 50 cycles at 92 °C for 15 s and 60 °C for 1 min. After PCR amplification, we performed an endpoint plate read on Applied Biosystems 7300 using the Sequence Detection System Software Core Application.

DNA was extracted from paraffin-embedded biopsies or surgical specimens. To determine the genotype of ALDH2, ALDH2 1951G>A (rs671) was subjected to analysis. TaqMan Drug Metabolism Genotyping Assays (Life Technologies Corp., CA, USA) was employed for genotyping using TaqMan SNP Genotyping Mix (ID: C-11703892-10; Life Technologies) according to the manufacturer’s instructions. Results of SNP genotyping were confirmed by PCR assay: f1 (caaattacagggtcaactgc) and r1 (acactcacagttttcacttc) were used to amplify ALDH2*1 allele and f2 (caaattacagggtcaactgc) and r2 (acactcacagttttcacttt) was used to amplify ALDH2*2 allele. PCR products were electrophoresed with 3% agarose gel and photographed. The 133 bp band shows both ALDH2*1 and ALDH2*2. All the results of the PCR assay were consistent with those of the Taqman probe assay. To further enhance the control of genotyping, the sequences of ALDH2 gene were examined by using sequencer for 5 samples. The results were again consistent with those of the TaqMan probe assay.

A total DNA was purified from leukocytes of 200 µl EDTA-anticoagulated blood obtained from the study participants using PureLink™ Genomic DNA Mini Kit (ThermoFisher Scientific, USA).
The SOD2 rs4880, GPX3 rs8177412, GSTP1(ab) rs1695, and GSTP1(cd) rs1138272 polymorphisms were assessed by the real-time PCR, following the manufacturer’s instructions supplied by TaqMan Drug Metabolism Genotyping assays (Life Technologies, Applied Biosystems, USA): C_8709053_10, C_2596717_20, C_3237198_20, and C_1049615_20, respectively. GPX1 rs1050450 polymorphism was determined by PCR – Restriction Fragment Length Polymorphism (PCR – RFLP) [19 (link)], while the Nrf2 rs6721961 polymorphism was determined by confronting 2-pair primers (CTPP) PCR method [20 (link)].

A total DNA was purified from EDTA-anticoagulated peripheral blood obtained from the study participants using PureLink™ Genomic DNA Mini Kit (ThermoFisher Scientific, United States).
GSTP1 rs1695, GSTP1 rs1138272, and GSTM3 rs1332018 polymorphisms were determined by real-time PCR on Mastercycler ep realplex (Eppendorf, Germany), using TaqMan Drug Metabolism Genotyping assays (Life Technologies, Applied Biosystems, United States). Assays' IDs were as follows: C_3237198_20, C_1049615_20, and C_3184522_30, respectively.
GSTM1 and GSTT1 deletion polymorphisms were determined by multiplex PCR, using CYP1A1 gene as an internal control. GSTA1 rs3957357 polymorphism was determined by PCR-restriction fragment length polymorphism (PCR-RFLP). Enzymatic digestion of amplified sequence was performed overnight at 37°C using EarI restriction enzyme (Thermo Fisher Scientific, United States). Primers sequences of GSTM1, GSTT1, CYP1A1, and GSTA1 genes and PCR protocols details are given in Table 1. PCR products were separated on 2% agarose gel stained with SYBR^® Safe DNA Gel Stain (Invitrogen, United States) and visualized on Chemidoc (Biorad, United States).

DNA was extracted from the blood samples using High Pure PCR Template Preparation Kits (Roche Applied Science). Subjects were genotyped for the ABCG2 421C>A (rs2231142) polymorphism by using the TaqMan Drug Metabolism Genotyping Assays from Applied Biosystems (Foster City, CA, USA).

DNA was isolated from blood samples with the QIAamp DNA Blood Mini kit (Qiagen, Hilden, Germany). Genotyping of CYP2C9*2 (rs1799853; NC_000010.10:g.96702047C > T), CYP2C9*3 (rs1057910; NC_000010.10:g.96741053A > C); CYP2C19*2 (rs4244285; NC_000010.10:g.96541616G > A); CYP2D6*4 (rs3892097; NC_000022.10:g.42524947C > T), CYP3A4*1B (rs2740574; NC_000007.13:g.99382096C > T) and CYP3A5*3 (rs776746; NC_000007.13:g.99270539C > T) alleles was performed with TaqMan® Drug Metabolism Genotyping Assays (Applied Biosystems, Foster City, USA). CYP2D6*5 allele, entailing CYP2D6 gene deletion, was analysed with TaqMan® Copy Number Assay (Applied Biosystems). All assays were performed with available commercial pre-designed kits. Assays were run on an ABI® 7500 Fast Real-Time PCR System (Applied Biosystems) and analysed with 7500 Software and CopyCaller (Applied Biosystems).
Individuals carrying none of the analysed defective alleles were predicted to carry normal functional allele since other defective alternative alleles are rare in our population, such as CYP2C19*3 which may be frequent in Asian populations as opposed to Caucasian.