The largest database of trusted experimental protocols

2 protocols using anti usp49

1

Western Blot Analysis of Lipid Metabolism

Check if the same lab product or an alternative is used in the 5 most similar protocols
For western blot assay, cell lysates were added with RIPA buffer with protease and phosphatase inhibitor (Thermo Fisher Scientific, Houston, TX). Following the centrifuging at 12,000 g under 4℃ for 12 min, the supernatants were examined by Western blotting. Antibodies used were as follows: anti‐FABP5 (Cat#:ab37267, abcam, UK), anti‐PDK1 (Cat#:ab52893, abcam, UK), anti‐p‐AKT (T308, Cat#:13038, Cell Signaling Technology), anti‐p‐AKT (Ser473, Cat#:4060S, Cell Signaling Technology), anti‐AKT (Cat#:4691, Cell Signaling Technology), anti‐p‐mTOR (Cat#:ab109268, abcam, UK), anti‐mTOR (Cat#:ab32028, abcam, UK), anti‐ACC1 (Cat#:ab45174), anti‐CD36 (Cat#:ab133625), anti‐VEGFA (Cat#:ab37267, Abcam, UK), anti‐ACOX1 (Cat#:ab184032, Abcam, UK) and anti‐FASN (Cat#:ab128870, Abcam, UK), anti‐USP49 (Proteintech), anti‐FKBP51 (Cat#:ab126715, Abcam, UK) and anti‐GAPDH from (Santa Cruz Biotechnology; Cambridge, MA).
+ Open protocol
+ Expand
2

Antibodies and Nucleic Acid Probes for Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), HRP-conjugated mouse anti-FLAG (Sigma, A8592)(1:1000), mouse anti-FLAG (Sungene, KM8002)(1:2000), anti-GFP (Sungene, KM8009)(1:2000) anti-β-Actin (KM9001)(1:2000), anti-Tubulin (KM9003), anti-GAPDH(KM9002), anti-HA (COVANCE, MMS-101R)(1:2000), anti-Ubiquitin (sc-8017)(1:500), anti-Ubiquitin K63-specific linkage (Millipore 05–1308)(1:500), rabbit anti-TBK1(Abcam, 96328–11), anti-p-TBK1(Abcam, 109272), anti-IRF3 (sc-9082)(1:1000), anti-p-IRF3 (Cell Singling Technologies, 4947S)(1:1000), anti-IκBα (sc-371)(1:1000), anti-p-IκBα (Cell Singling Technologies, 9246L)(1:1000), anti-USP49 (proteintech,18066-1-AP), anti-mouse MITA and anti-human MITA (Cell Singling Technologies,13647) (proteintech, 19851-1-AP) were purchased from the indicated manufactures. ISD45, DNA90, and HSV120 were previously described [44 (link), 45 (link), 72 (link), 73 (link)]. ISD45: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; DNA90: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; HSV120: 5’-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3’.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!