Histidine

The full-length coding regions of Dvl1, Syt-1, Sxt-1A, Vamp2 and SNAP25 were fused in-frame to the GAL4 DNA-BD of pGBKT7 (BD) or to the GAL4 activation domain (AD) of pGADT7 (Clontech). Primers for Dvl1 were forward (Fwd): 5′-CGTACAGAATTCGCGGAGACCAAAATCAT-3′ and reverse (Rvs): 5′-GGCTAGTCGACCATGATGTCCACAAAG-3′. Primers used for Syt-1 were Fwd: 5′-AAGTACGAATTCGTGAGTGCCAGTCGTCCTGAGG-3′ and Rvs: 5′-AAGTACCTCGAGCTTCTTGACAGCCAGCATGG-3′. For Sxt-1A Fwd: 5′-AAGTACATCGATACAAGGACCGAACCGAGGAGC-3′ and Rvs: 5′-AAGTACCTCGAGTCCAAAGATGCCCCCGATGG-3′. Primers used for VAMP2 were Fwd: 5′-AAGTACGAATTCTCGGCTACCGCTGCCACCG-3′ and Rvs: 5′-AAGTACCTCGAGAGTGCGGCTGGGGGTGGG-3′ and for SNAP25 Fwd: 5′-AAGTACGAATTCGCCGAAGACGCAGACATGCGC-3′ and Rvs: 5′-AAGTACCTCGAGACCACTTCCCAGCATC-3′. Empty pGBKT7- and GAL4 DNA-BD Dvl1 fusions were transformed into the yeast strain AH109 (MATa), whereas the empty pGADT7 and GAL4 AD fusions were transformed into the Y187 strain (MATα from Clontech). Three yeast transformants for each plasmid combination were mated on rich YPDA medium and selected under nutrition restriction on plates containing synthetic media without Leucine and Tryptophan (Clontech). Protein interactions were then assayed by monitoring growth on synthetic media lacking Histidine or Histidine and Adenine (Clontech).

To perform the yeast two hybrid screen the AH109 yeast strain (MATa), transformed with the GAL4 DNA binding domain (BD) Dvl1 fusion, was mated with the Y187 strain (MATα), transformed with a cDNA library isolated from adult mouse brain (Clonetech), according to the manufacture’s instructions. For the yeast two hybrid assays empty pGBKT7 and GAL4 DNA binding domain (BD) Dvl1 fusion were transformed into the yeast strain AH109 (MATa), whereas the empty pGADT7 and Eps8L3-GAL4 activation domain (AD) fusion were transformed into the Y187 strain (MATα). Two yeast transformants for each plasmid combination were mated on rich YPDA medium and selected under nutrition restriction on plates containing synthetic media without Leucine and Tryptophan (Clontech). Protein interactions were then assayed by monitoring growth on synthetic media lacking Histidine or Histidine and Adenine (Clontech).

Yeast strains were grown at 37 °C in synthetic minimal media, with agar, Gal/raf with or without dropout (-uracil, -ura; -leucine, -leu; -histidine, -his) were purchased from Clontech and prepared as recommended by the manufacturer. Transformations were carried out as described in Gateway manual (Invitrogen, Carlsbad, CA, USA). Zebrafish (primers F: CACCATGGCTCGTCATGGAAAAGGC R: TTAAATTCTTTTCGACATGTATGG) Elp3 was cloned into the pYES-DEST52 destination vector (Invitrogen) using Gateway. Wild type control yeast BY4741 and ΔELP3 (kindly provided by de Crecý-Lagard) were plated in solid media in serial dilutions of 1:10 factor from left to right.