p38γ and p38δ expression was reduced by RNA interference using Mission shRNA constructs (Sigma; plasmid clone IDs TRCN0000006145 and TRCN0000006147 for p38γ and plasmid clone IDs TRCN0000000827 and TRCN0000009979 for p38δ). A lentivirus containing the control pLKO.1 or the shRNA plasmids was used to infect MDA-MB-231 cells. To produce the virus, HEK293T cells were transfected using Lipofectamine 2000 (Invitrogen) with empty pLKO.1-puro vector or the shRNA constructs against p38γ or p38δ, together with the packaging vectors (psPAX2 and pMD2.G) in serum-reduced medium. On the following day, the medium was replaced with complete DMEM and, after 24 h, the lentivirus-containing supernatant was collected, filtered, and used to transduce MDA-MB-231 cells. Cells containing the shRNA plasmid were selected, expanded, and maintained with supplementation of puromycin (2 mg/ml) for approximately 3 weeks, during which time cell lysates were collected every 3 to 4 days to ensure the respective p38 expression levels were reduced throughout the selection period.
Mission shrna constructs
Manufactured by Merck Group
Sourced in United States
MISSION shRNA constructs are a set of gene-specific short hairpin RNA (shRNA) molecules designed for gene knockdown studies in mammalian cells. The constructs are packaged in lentiviral particles, enabling efficient transduction and stable expression of the shRNA in target cells. The MISSION shRNA library provides a comprehensive coverage of the human and mouse genomes.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Merck Group (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
24 well ultra low attachment plate, by Corning (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Advanced dmem, by Thermo Fisher Scientific (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Mycosensor pcr assay kit, by Agilent Technologies (1 mentions)
Fugene, by Promega (1 mentions)
Shc002, by Merck Group (1 mentions)
Shc003, by Merck Group (1 mentions)
Pspax2, by Addgene (1 mentions)
Plx sgrna vector, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Attractene transfection reagent, by Qiagen (1 mentions)
Lentivirus qpcr titer kit, by Applied Biological Materials (1 mentions)
15 protocols using mission shrna constructs
1
Targeted Silencing of p38γ and p38δ
2
Sphere Culture and Lentiviral Transduction of Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both the lung cancer cell line A549, purchased from ATCC, and head and neck cancer cell line UM-SCC 22A (SCC22A) [8 (link),37 (link)] were expanded and stored in liquid nitrogen. Cell lines were cultured in advanced DMEM (Gibco/Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 2 mM L-glutamine (Life Technology/Thermo Fisher Scientific, Inc., Waltham, MA, USA), Penicillin-Streptomycin (Gibco), plus 10% FBS. For three-dimensional (3D) sphere cultures, cells were plated in ultra-low attachment 24-well plates (Corning Costar, Corning, NY, USA) in serum-free medium containing TGFβ [5 ng/mL] or vehicle (1 mg/mL BSA in 4 mM HCl) and cultured for 6 days before analysis. All cell lines were tested for mycoplasma contamination by applying MycoSensor PCR Assay kit according to manufacturer’s instructions (Agilent Technologies, Inc., Santa Clara, CA, USA). For La-specific shRNA-mediated depletion lentiviral transduction of MISSION shRNA constructs (TRCN0000062193 and TRCN0000062195) were performed according to the manufacture’s instruction (Sigma-Aldrich, St. Louis, MO, USA). All lentiviral experiments were performed under biosafety level S2 at our laboratory at the Medical University of South Carolina (Charleston, SC, USA).
3
Genetic Manipulation of Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HuSHTM shRNA constructs (Origene Technologies, Rockville, MD, USA) were used to reduce gene expression of mouse HIF-1α. MISSION shRNA constructs (Sigma-Aldrich) were used to reduce the expression of JAK1 and JAK2. shRNA sequences are provided in Supplementary Table 4 . Control cultures for these experiments were transfected with either the pRS-sh-scrambled control vector (Origene Technologies, Rockville, MD, USA) or the TRC1.5 (Sigma-Aldrich) control vector, respectively. The pRc/CMV-STAT3c plasmid (plasmid 8722, Addgene, Cambridge, MA, USA)49 (link) was used to express a constitutively active form of STAT3, STAT3C. pEGFP (Clontech, Mountain View, CA, USA) was used in our studies as the control for STAT3C transfection experiments. The m67 pTATA TK-luc plasmid (plasmid 8688, Addgene, Cambridge, MA, USA)87 was used as the backbone for constructing a luciferase reporter, pSTAT3 TK-luc, to measure the transcriptional activity of STAT3. Four copies of the STAT-binding site (TTCCCGTAA) were introduced into the AccI and BamHI sites of pTATA-TK-Luc upstream of the minimal promoter. The Renilla luciferase reporter phRL tk-luc (Promega, Madison, WI, USA) was used in the luciferase assay as per the manufacturer’s protocol.
4
Lentiviral Knockdown in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were cotransfected with pLKO.1-puro (vector containing the shRNA sequence), pLP1, pLP2, and pLP/VSVG plasmids with FuGENE (Promega). Forty-eight hours later, the medium containing lentiviruses was used to infect HeLa cells, and positive cells were selected with 2 µg/mL puromycine. The following MISSION shRNA constructs (Sigma) were used: shRNA anti-ADA3 (TRC no. TRCN0000015734) and shRNA nontarget control (product no. SHC002). shATXN7L3 and the corresponding shCtrl cells were described (Lang et al. 2011 (link)).
5
Silencing Mitochondrial Complex II Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To silence SDHD, SDHB and SDHAF2, three validated MISSION® shRNA constructs (TRCN0000231553 -236398, -159253 respectively) targeting human SDHD (NM_003002.1), SDHB (NM_003000.2), and SDHAF2 (NM_017841.2) (Sigma Aldrich, St. Louis, USA) or scramble shRNA encoding plasmid (SHC002 Sigma Aldrich) were used to produce infectious virus particles (LV). To evaluate the transduction efficiency, the MISSION TurboGFP control plasmid (SHC003 Sigma Aldrich) was used. HEK293T cells were transfected with the shRNA constructs together with helper plasmids encoding HIV-1 gag-pol, HIV-1 rev, and the VSV-G envelope as described [41 (link)]. Viral supernatants were added to HEK293 cells in fresh medium supplemented with 8 μg/ml Polybrene (Sigma Aldrich) and the cells were incubated overnight. The next day, the medium was replaced with fresh medium. Transduction efficiency was analysed 3 to 6 days post transduction by evaluating GFP labelled cells. Experiments were performed 2-3 and 4-5 weeks after transduction of HEK293 cells with shRNAs.
6
Lentiviral shRNA Knockdown of GRP1 and Related Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA against GRP1 (GRP1sh_1) was generated as previously published68 (link). Briefly, a short hairpin RNA targeting GRP1 mRNA was subcloned into the lentiviral expression plasmid pLKO.1 using the following primer sequences: Fwd: 5’- CCGG—GCATTAAGAACGAGCCATTTA—CTCGAG—TAAATGGCTCGTTCTTAATGC—TTTTTG-3’; Rev: 5’- AATTCAAAAA— GCATTAAGAACGAGCCATTTA —CTCGAG— TAAATGGCTCGTTCTTAATGC −3’. The annealed oligos were further ligated between the AgeI and EcoRI sites of the pLKO.1 TRC-cloning vector. Positive clones were screened using EcoRI and NcoI double digestion and validated by sequencing. Additional MISSION shRNA constructs in the pLKO.1 background were purchased from Sigma-Aldrich. CYTH2:TRCN0000062100, CYTH1:TRCN0000062116, CYTH3:TRCN0000179183.
7
Knockdown of Autophagy Genes in Human Cells
8
Lentiviral shRNA Knockdown of GRP1 and Related Proteins
9
Lentiviral Knockdown of ATG16L1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus based knockdown of human ATG16L1 (5′-ACTGTAGCTTTGCCGTGAATG-3′) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system. psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260). Lentivirus-expressing shRNAs were produced by DNA transfection using Lipofectamine 3000 (Thermo Fisher). Transduction was performed using Polybrene (Millipore) and selection was done using 1 μg/mL puromycin.
10
Generating Gene Knockout Cell Lines
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!