Trizol rna isolation

Total RNA was isolated using TRIZOL RNA Isolation (QIAGEN, Germantown, MD) according to the manufacturer’s instructions. cDNA was synthesized with the qScript cDNA SuperMix (QuantaBio, Beverly, MA). qRT-PCR was performed in an ABI 7600 FAST thermal cycler. SYBR Green quantitative gene expression analysis was performed using ABsolute Blue qRT-PCR SYBR Green Low ROX Mix (ThermoScientific) and the following primers: TDO2 forward 5’- CGGTGGTTCCTCAGGCTATC-3’ and reverse 5’- CTTCGGTATCCAGTGTCGGG-3’; IL6 forward 5’- AAGCCAGAGCTGTGCAGATGA-3’ and reverse 5’- AACAACAATCTGAGGTGCCCA; HMOX-1 forward 5’-CAGGCAGAGAATGCTGAGTTC-3’ and reverse; GDF-15 forward 5’-CTCAGGACGCTGAATGGCTCT-3’ and reverse 5’-GGGTCTTGCAAGGCTGAGCTG-3’; PD-L1 forward 5’-TATGGTGGTGCCGACTACAA-3’ and reverse 5’-TGGCTCCCAGAATTACCAAG-3’; ZEB1 forward 5’-TCCATGCTTAAGAGCGCTAGCT-3’ and reverse 5’-ACCGTAGTTGAGTAGGTGTATGCCA-3’; GAPDH forward 5’-GTCAGTGGTGGACCTGACCT-3’ and reverse 5’-AGGGGTCTACATGGCAACTG-3’; β-actin: FP- CTGTCCACCTTCCAGCAGATG RP-CGCAACTAAGTCATAGTCCGC. Taqman quantitative gene expression analysis for miR-200c and U6 was performed with primer-specific reverse transcriptase using the following TaqMan MicroRNA Assays (Applied Biosystems/ThermoFisher): miR-200c assay ID #002300; U6 assay ID #001973. All experiments were performed in biological triplicate.