Samples from cultured cells and explanted xenografts were processed using the RNA II kit (Macherey-Nagel) according to the manufacturer's protocol. 1 to 5 μg total RNA were transcribed using the RNA to cDNA EcoDry Premix (Random Hexamers) kit (Clontech). qPCRs were run on a Roche LightCycler LC480, using the following program: 5 min pre-incubation at 95°C, 40 amplification cycles (10 sec 95°C, 10 sec 60°C, 10 sec 72°C) and melting curve. Obtained data was analyzed using the Biogazelle qbase+ software. Employed PCR primers were: HPRT1 (forward: CCTGGCGTCGTGATTAGTGAT; reverse: AGACGTTCAGTCCTGTCCATAA); ACTB (forward: CCTCGCCTTTGCCGATCCG; reverse: CCACC ATCACGCCCTGGTG); GAPDH (forward: GAAGGTG AAGTTCGGAGTC; reverse: GAAGATGGTGATGGG ATTTC); RNA18S5 (forward: GTTCCGACCATAAAC GATGC; reverse: TGGTGGTGCCCTTCCGTCAAT); TBP (forward: TTCGGAGAGTTCTGGGATTGT; reverse: TGGACTGTTCTTCACTCTTGG C); HMBS (forward: ATGTCTGGTAACGGCAATGC; reverse: CGTCTGTAT GCGAGCAAGC); URI1 (forward: AATGCCCTTCGA GAAAGACTCA; reverse: CCCCCAGTAAAACAGTG ACTTC); BBC3/Puma (forward: GACCTCAACGCAC AGTACGAG; reverse: AGGAGTCCCATGATGAGAT TGT); PMAIP1/Noxa (forward: GCAAGAACGCTCAA CCGAG; reverse: AAGTTTCTGCCGGAAGTTCA); CDKN1A (forward: AGTCAGTTCCTTGTGGAGCC; reverse: CATGGGTTCTGACGGACAT); MDM2 (forward: TGTTGTGAAAGAAGCAGTAGCA; reverse: CCTGATCCAACCAATCACCT).
Rna 2 kit
Manufactured by Macherey-Nagel
Sourced in Germany, Switzerland
The RNA II kit is a laboratory equipment product designed for the isolation and purification of RNA from various biological samples. It provides a reliable and efficient method for extracting high-quality RNA for downstream applications, such as real-time PCR, reverse transcription, and other molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler lc480, by Roche (1 mentions)
Ecodry premix random hexamers kit, by Takara Bio (1 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Omniscript rt kit, by Qiagen (1 mentions)
4 protocols using rna 2 kit
1
Quantitative PCR protocol for gene expression
2
RT-qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from homogenized tissue using the RNAII Kit (Machery‐Nagel; Düren, Germany) according to the manufacturer′s instructions. Real‐time reverse transcription polymerase chain reaction for gene expression analysis was performed with the ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Waltham, MA). Primers were bought as assays on demand (Applied Biosystems, Waltham, MA; primers listed below). The polymerase chain reaction was performed in a final volume of 25 μL containing 1 μL cDNA, 12.5 μL Master Mix (Applied Biosystems, Waltham, MA), 1 μL fluorogenic hybridization probe, 6 μL primer mix, and 5.5 μL distilled water. The amplification consisted of a 2‐step polymerase chain reaction (40 cycles; 15‐s denaturation step at 95°C and 1 minute annealing/extension step at 60°C). Specific gene expression was normalized to the housekeeping gene β actin given by the formula 2‐ΔCt. The result for the relative gene expression was calculated by the 2‐DDCt method. The mean Ct values were calculated from double determinations, and samples were considered negative if the Ct values exceeded 40 cycles. Primers are described in Data S1 .
3
Inflammasome Activation in MG-63 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human WT MG-63 and CASP1 -/-MG-63 G2 cells were exposed to inducers of inflammasomes activation, 5 mM ATP for 30 min, following by the exposure to 5 mg/mL nigericin for 3 h. Relative NLRP3 mRNA expression was evaluated by quantitative Real-Time PCR (qRT-PCR), as described (Deplanche et al., 2015) . Briefly, the total RNA was isolated with a RNA II kit (Macherey Nagel) and the cDNA was synthesized using a qScript cDNA Synthesis kit (Quanta Biosiences). Reactions devoid of reverse transcriptase and reactions containing H2O instead of cDNA were used as negative controls. Primers for human NLRP3 were designed according to the sequences The relative mRNA level was calculated as × deltaCT (x = Primer efficiency).
After normalization relative quantification refers to the PCR signal of the target transcript in a treatment group divided by the values obtained from control cells arbitrarily set to 1 at the indicated period. Western blot analysis. Pro-caspase-1 and cleaved caspase-1 were detected by Western blot analysis as described (Berkova et al., 2006) . Briefly, 2.5x10 5 of cells were grown in 12-well plates. Pro-caspase-1 was detected in non-stimulated and stimulated cells, while active caspase-1 was detected solely in stimulated cells. Wild type (WT)
After normalization relative quantification refers to the PCR signal of the target transcript in a treatment group divided by the values obtained from control cells arbitrarily set to 1 at the indicated period. Western blot analysis. Pro-caspase-1 and cleaved caspase-1 were detected by Western blot analysis as described (Berkova et al., 2006) . Briefly, 2.5x10 5 of cells were grown in 12-well plates. Pro-caspase-1 was detected in non-stimulated and stimulated cells, while active caspase-1 was detected solely in stimulated cells. Wild type (WT)
4
CFTR mRNA Expression Analysis in ALI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA harvesting was performed on inserts at the ALI for 24 days with the RNA II kit (Macherey-Nagel, Oensingen, Switzerland) and complementary deoxyribonucleic acid (cDNA) synthesis was done with Omniscript RT Kit (Qiagen, Valencia, CA, USA). RT-PCR measurements were performed with the Taqman Fast Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on a 7500 Fast Real-Time PCR System (Applied Biosystems). Sequences of the primers and probe used for the detection of the CFTR transcript: forward primer: 5’-AGCTGTCAAGCCGTGTTCTAGATA-3′, reverse primer 5’-ATGAGGAGTGCCACTTGCAAA-3′, probe 5’-FAM-CACACGAAATGTGCCAATGCAAGTCCTT-TAMRA-3′. The CFTR mRNA levels where standardized to the housekeeping ribosomal 18S RNA by using the following primers/probe set: forward primer 5’-CGCCGCTAGAGGTGAAATTCT-3′, reverse primer 5’-CATTCTTGGCAAATGCTTTCG-3′, probe 5’-FAM-ACCGGCGCAAGACGGACCAGA-TAMRA-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!