Log In Sign up
The largest database of trusted experimental protocols

Stannous 2 ethylhexanoate sn oct 2

Manufactured by Merck Group
Visit Supplier
Sourced in United States

Stannous 2-ethylhexanoate [Sn(Oct)2] is a tin-based organometallic compound used as a catalyst in various industrial and laboratory applications. It is a colorless to pale yellow liquid with a characteristic odor. The compound is soluble in organic solvents and is primarily used as a catalyst in the synthesis of polyurethanes, silicones, and other polymeric materials.

Automatically generated - may contain errors

Lab products found in correlation

ε caprolactone ε cl, by Merck Group (2 mentions) ε caprolactone, by Merck Group (2 mentions) Poloxamer 188, by BASF (2 mentions) Benzyl bromide, by Merck Group (2 mentions) Tetrabutylammonium bromide, by Merck Group (1 mentions) Potassium bromide kbr, by Merck Group (1 mentions) Sodium thiosulfate na2s2o3, by Merck Group (1 mentions) Sodium azide nan3, by Merck Group (1 mentions) Sodium azide, by Merck Group (1 mentions) Propargyl bromide, by Merck Group (1 mentions) Penicillin streptomycin pen strep, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Dimethyl sulfoxide (dmso), by Merck Group (1 mentions) Glutaraldehyde, by Merck Group (1 mentions) N dimethylformamide dmf, by Merck Group (1 mentions) Acetic acid, by Merck Group (1 mentions) Toluene, by Thermo Fisher Scientific (1 mentions) Dimethylformamide, by Thermo Fisher Scientific (1 mentions) Dichloromethane, by Thermo Fisher Scientific (1 mentions) Ethyl ether, by Thermo Fisher Scientific (1 mentions)

14 protocols using stannous 2 ethylhexanoate sn oct 2

1

Synthesis of Alkyne-functionalized Benzoin

Check if the same lab product or an alternative is used in the 5 most similar protocols

ε-Caprolactone (ε-CL) (Aldrich) and Cyclohexene oxide (CHO) (Aldrich) were distilled over calcium hyride (CaH2) and stored in a refrigerator under nitrogen before use. Acetylene-functionalized benzoin (PI-alkyne) was synthesized by slightly modifying the procedure described in the literature.[15 (link)] Stannous-2-ethylhexanoate (Sn(Oct)2) (Aldrich), 3-cyclohexene-1-methanol (Aldrich), Sodium azide (Aldrich), Propargyl bromide (80 wt. % in toluene, Aldrich), Diphenyliodonium hexafluorophosphate (Fluka), CuBr (Aldrich), Iodic acid (HIO3) (Sigma-Aldrich), Potassium bromide (KBr) (Sigma-Aldrich), Sodium thiosulfate (Na2S2O3) (Sigma-Aldrich), Sodium azide (NaN3) (Merck), Tetrabutylammonium bromide (Sigma-Aldrich), and 2,2ꞌ-bipyridine (Merck) were used as received. 1-Ethoxy-2-methylpyridinium hexafluorophosphate (EMP+PF6−) was prepared according to the published procedure.[33 (link)] Solvents, dichloromethane (CH2Cl2), toluene, and tetrahydrofuran (THF), were distilled over drying agents under nitrogen prior to use.
Uyar Z., Degirmenci M., Genli N, & Yilmaz A. (2016). Synthesis of well-defined bisbenzoin end-functionalized poly(ε-caprolactone) macrophotoinitiator by combination of ROP and click chemistry and its use in the synthesis of star copolymers by photoinduced free radical promoted cationic polymerization. Designed Monomers and Polymers, 20(1), 42-53.
+ Open protocol
+ Expand
2

Chloroquine-Loaded Polymeric Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
The study was conducted in Zanjan University of Medical Sciences, Zanjan, Iran in 2018. Chloroquine (CQ) were purchased from Sigma Co. (Germany), PEG (Mn=6000Da) (Aldrich, St. Louis, USA, CAS.9004744), stan-nous 2-ethyl-hexanoate (Sn(Oct)2
) (Aldrich, St. Louis, USA, CAS. 301100), ε-caprolactone (97% purity) (Aldrich, USA, CAS. No 502443), PLN (Sigma-Aldrich, USA), ethanol, acetone, and all reagents and chemicals used in this work were analytical grade.
Rashidzadeh H., Zamani P., Amiri M., Hassanzadeh S.M, & Ramazani A. (2022). Nanoincorporation of Plumbagin in Micelles Increase Its in Vivo Anti-Plasmodial Properties. Iranian Journal of Parasitology, 17(2), 202-213.
+ Open protocol
+ Expand
3

Polypeptide Nanoparticle Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cur was purchased from Hangzhou Guang Lin Biological Pharmaceutical Co. Ltd. (Hangzhou, China). (ACP)-GPLGIAGQr9-(ACP) was from ChinaPeptides Co. Ltd. (Shanghai, China). Poloxamer188 was obtained from BASF (Shanghai, China). Stannous 2-ethylhexanoate [Sn(Oct)2] was obtained from Sigma (St. Louis, MO, USA). Dialysis bags (MWCO = 14,000) were obtained from Gene Star Co. (Shanghai, China). L929 mouse embryonic fibroblasts and A549 cells were from the Cell Bank of the Chinese Academy of Sciences (Beijing, China). Kunming mice were obtained from Zhejiang Academy of Medical Sciences (Hangzhou, China). mPEG (Mn = 1900) and ε-caprolactone (ε-CL) were purchased from Aladdin Chemicals (Shanghai, China). Other reagents (analytical or chromatographic grade) were obtained from Aladdin Chemicals.
Guo F., Wu J., Wu W., Huang D., Yan Q., Yang Q., Gao Y, & Yang G. (2018). PEGylated self-assembled enzyme-responsive nanoparticles for effective targeted therapy against lung tumors. Journal of Nanobiotechnology, 16, 57.
+ Open protocol
+ Expand
4

Biomaterial-Based Antimicrobial Wound Dressing

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCL (Mn = 80,000), CS (75–85% deacetylated, medium molecular), sodium triphosphate pentabasic (TPP), poly 4, 4’-methylenebis(phenylisocyanate)-alt-14 butanediol/dipropyleneglycol/polycaprolactone, glutaraldehyde, meso tetrakis(N-methyl pyridinium-4-yl)porphyrin tetratosylate salt, 3,(4,5-dimethyithiazol-2-yl)2,5-diphenyl-tetrazolium bromide (MTT), N, N-dimethylformamide (DMF), Dimethyl sulfoxide (DMSO), and Stannous 2-ethyl hexanoate (Sn(Oct)2) were purchased from Sigma-Aldrich. Polyethylene glycol (PEG4000), Nutrient Broth, ε-caprolactone (ε-CL), and Acetic acid were obtained from Merck Chemical Co. Trypsin/EDTA solution (0.25%), Phosphate-buffered saline (PBS), Penicillin-Streptomycin (Pen-Strep), High-glucose content Dulbecco’s Modified Eagle Medium (DMEM/HG), and Fetal Bovine Serum (FBS) were supplied from GIBCO. Human fetal foreskin fibroblast (HFFF2) cells were obtained from the Iranian Cell Bank (Pasteur Institute, Iran). Gram-positive Staphylococcus aureus (ATCC 25,923) and Gram-negative Escherichia Coli (ATCC 25,922) were obtained from the National Collection of Industrial Microorganisms (NCIM, Iran).
Saghebasl S., Amini H., Nobakht A., Haiaty S., Bagheri H.S., Hasanpour P., Milani M., Saghati S., Naturi O., Farhadi M, & Rahbarghazi R. (2023). Polyurethane-based nanofibrous mat containing porphyrin with photosensitivity and bactericidal properties can promote cutaneous tissue healing in rats. Journal of Nanobiotechnology, 21, 313.
+ Open protocol
+ Expand
5

Synthesis of PCL Polymers

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCL (Mn = 45000
g mol–1), ε-caprolactone (CL, >99%), stannous
2-ethyl hexanoate (Sn(Oct)2, purity 92.5–100.0%),
cyclohexanol (purity 98.5%), and 2-chloro-4,4,5,5-tetramethyl-1,3,2-dioxaphospholane
(TMDP, purity 95%) were acquired from Sigma-Aldrich (St. Louis, MO).
Alkaline LN was acquired from TCI Inc. (Portland, OR). Methanol (purity
≥99%), dichloromethane (DCM, purity ≥99.9% extra dry),
oxalyl chloride (purity ≥99%), dimethylformamide (DMF,
purity ≥99.5%), dimethyl sulfoxide (DMSO, purity ≥99.7%),
ethyl ether (purity ≥99%), toluene (purity ≥99.5%, extra
dry), and trehalose (purity ≥99%) were acquired from Fisher
Scientific (Pittsburgh, PA).
Garcia A., Astete C.E., Cueto R, & Sabliov C.M. (2024). Modulation of Methoxyfenozide Release from Lignin Nanoparticles Made of Lignin Grafted with PCL by ROP and Acylation Grafting Methods. Langmuir, 40(10), 5433-5443.
+ Open protocol
+ Expand
6

Synthesis and Characterization of mPEG-Based Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Benzyl bromide, 2,2-bis(hydroxymethyl)propionic acid, methoxy poly(ethylene glycol) (mPEG, Mn = 5000, PDI = 1.03), and stannous 2-ethylhexanoate (Sn(Oct)2) were purchased from Sigma-Aldrich (St. Louis, MO). Tetraethylenpentamine and dodecanol were purchased from Alfa-Aesar (Ward Hill, MA). TaqMan reverse transcription reagent kit was purchased from Life Technologies (Grand Island, NY). Radioimmunoprecipitation assay (RIPA) buffer and SYBR green-1 were purchased from (Roche, Indianapolis, IN). miR-let7b (mature sequence UGAGGUAGUAGGUUGUGUGGUU) and scrambled miRNA were purchased from Invitrogen (Carlsbad, CA). All other reagents were purchased from Sigma-Aldrich and used without further purification.
Kumar V., Mondal G., Slavik P., Rachagani S., Batra S.K, & Mahato R.I. (2015). Codelivery of Small Molecule Hedgehog Inhibitor and miRNA for Treating Pancreatic Cancer. Molecular pharmaceutics, 12(4), 1289-1298.
+ Open protocol
+ Expand
7

Synthesis and Characterization of Polymeric Materials

Check if the same lab product or an alternative is used in the 5 most similar protocols

l-Lactide (LA, Serva Feinbiochemica) was recrystallized from toluene twice, polyethylene glycol monomethyl ether (mPEG2k, Sigma-Aldrich) was dried under reduced pressure, and stannous 2-ethylhexanoate (Sn(Oct)2, ∼95%, Sigma-Aldrich) was dried over molecular sieves. Dicyclohexylcarbodiimide (DCC), 4-(dimethylamino)pyridine (DMAP), ammonium hydroxide, hydrochloric acid (37%), succinic anhydride, p-phenylenediamine, N-phenyl-p-phenylenediamine, and phenyl hydrazine (97%) were all obtained from Sigma-Aldrich and used without further purification; ammonium persulfate, ethanol, and dichloromethane were obtained from VWR. Dimethylformamide (DMF, HPLC, VWR) was dried over CaH2 and distilled under reduced pressure before use. Methanol (MeOH, HPLC, Fisher Scientific), trichloroacetyl isocyanate (96%, Sigma-Aldrich), 1,6-diphenyl-1,3,5-hexatriene (DPH, 98%, Sigma-Aldrich), chloroform (99%, Fisher Scientific), diethyl ether (99.8%, Sigma-Aldrich), anhydrous tetrahydrofuran (THF, Sigma-Aldrich), and hexamethylene diisocyanate (HMDI, 99%, Sigma-Aldrich) were all used without further purification.
Glavas L., Odelius K, & Albertsson A.C. (2014). Induced redox responsiveness and electroactivity for altering the properties of micelles without external stimuli †Electronic supplementary information (ESI) available. See DOI: 10.1039/c4sm00258j Click here for additional data file.. Soft Matter, 10(22), 3859-3860.
+ Open protocol
+ Expand
8

Synthesis and Characterization of Biodegradable Polymers

Check if the same lab product or an alternative is used in the 5 most similar protocols
(3s)-cis-3,6-dimethyl-1,4-Dioxane-2,5-dione (L-lactide) was purchased from SigmaAldrich Inc. (St. Louis, MO) and purified by recrystallization from toluene. Stannous 2ethylhexanoate (Sn(Oct)2) and 2-hydroxyethyl methacrylate (HEMA) were purchased from Sigma-Aldrich Inc. and distilled under reduced pressure before use. 1,4-Dioxane (99%) was purchased from Aldrich Chemical (Milwaukee, WI) and dehydrated with calcium chloride. 2,2’-Azoisobutyronitrile (AIBN) was purchased from Sigma-Aldrich Inc. and recrystallized from ethanol. PLLA (inherent viscosity 1.6 dL/g) was purchased from Boehringer Ingelheim (Ingelheim, Germany). Poly(ethylene glycol) monomethyl ether methacrylate (PEGMA), FITC labeled BSA, 3-aminopropyltriethoxysilane (APTS), 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA), Ncetyltrimethylammonium bromide (CTAB), tetraethyl orthosilicate (TEOS), 1,3,5trimethylbenzene (TMB) and ammonium hydroxide, polyethyleneimine (PEI, Mw 800 Da and 25 kDa), poly(ethylene glycol) (PEG, Mw 2000, 5000, 10000, and 20000 Da), and hyperbranched bis-MPA polyester (H20: 16 hydroxyls, H30: 32 hydroxyls, and H40: 64 hydroxyls) were purchased from Sigma–Aldrich Inc. and used without further treatment.
Liu Z., Chen X., Zhang Z., Zhang X., Saunders L., Zhou Y, & Ma P.X. (2018). Nanofibrous Spongy Microspheres to Distinctly Release miRNA and Growth Factors to Enrich Regulatory T Cells and Rescue Periodontal Bone Loss. ACS nano, 12(10), 9785-9799.
+ Open protocol
+ Expand
9

Synthesis and Characterization of (ACP)-GPLGIAGQr9-(ACP) Peptide

Check if the same lab product or an alternative is used in the 5 most similar protocols
(ACP)-GPLGIAGQr9-(ACP) was purchased from ChinaPeptides Co. Ltd. (Shanghai, China). Poloxamer-188 was from BASF (Shanghai, China). 4-Aminophenylmercuric acetate (APMA), collagenase IV, stannous 2-ethylhexanoate [Sn(Oct)2], and MePEG (Mw = 1.9 kDa) were received from Sigma-Aldrich (Shanghai, China). Fetal calf serum, pancreatic enzymes, and Dulbecco’s modified Eagle’s medium (DMEM) were from Hangzhou Yu Jie Biotechnology Co. Ltd. (Hangzhou, China). Curcumin was purchased from Hangzhou Guang Lin Biological Pharmaceutical Co. Ltd. (Hangzhou, China). Dialysis bags (MWCO = 14 kDa) were obtained from Gene Star Co. (Shanghai, China). Other reagents (analytical or chromatographic grade) were obtained from Aladdin Chemicals (Shanghai, China).
Guo F., Fu Q., Zhou K., Jin C., Wu W., Ji X., Yan Q., Yang Q., Wu D., Li A, & Yang G. (2020). Matrix metalloprotein-triggered, cell penetrating peptide-modified star-shaped nanoparticles for tumor targeting and cancer therapy. Journal of Nanobiotechnology, 18, 48.
+ Open protocol
+ Expand
10

Synthesis and Characterization of PEG-Peptide Conjugates

Check if the same lab product or an alternative is used in the 5 most similar protocols
TP (purity, >98%) was purchased from the National Institutes for Food and Drug Control (Beijing, People’s Republic of China). Toluene (99%; Sigma-Aldrich Co., St Louis, MO, USA) was refluxed with a sodium bead/benzophenone complex and distilled until the solution turned purple. Dilactide was purchased from J&K Chemicals Ltd. (Shanghai, People’s Republic of China), recrystallized three times from ethyl acetate, and stored under vacuum prior to use. PEG methyl ether (PEG-OH; Sigma-Aldrich Co.) (99%; molecular weight [MW]=5,000 g/mol), maleimide-PEG-hydroxy (Mal-PEG-OH) (America; MW=5,000 g/mol; >95%), and stannous 2-ethylhexanoate (Sn[Oct]2) (99%; Sigma-Aldrich Co.) were used as received without further purification. FSH-β peptide (YTRDLVYKDPARPNTQKVCTF) was synthesized via solid-phase peptide synthesis by ChinaPeptides Co., Ltd. (Shanghai, People’s Republic of China), purified by high-performance liquid chromatography (HPLC), and identified by mass spectrometry (MS). Its MW was 2,515.89, and the purity of the peptide was >95%.
Chen X.Y., Chen W.L., Ma M., Gu C., Xiao X.R, & Li B. (2015). The potential of follicle-stimulating hormone peptide-modified triptolide-loaded nanoparticles to induce a mouse model of premature ovarian insufficiency. International Journal of Nanomedicine, 10, 2765-2774.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!