Gastrocnemius tissue and HUVECs were lysed to extract proteins. Protein lysates (50 μg) were loaded and separated on the SDS‐PAGE gel. Then, proteins were transferred onto nitrocellulose membranes. Membranes were incubated with the corresponding primary antibodies against cleaved caspase‐3 (Abcam, ab49822), caspase‐3 (Abcam, ab13847), Bcl‐2 (Abcam, ab182858), BAX (Abcam, ab32503), LXRα (Abcam, ab176323), LXRβ (Abcam, ab28479), NOX4 (Abcam, ab109225), 3‐Nitrotyrosine (Abcam, ab52309), SIRT1 (Cell Signaling, #9475), hydroxylated HIF‐1α (Cell Signaling, #3434), FoxO1 (Cell Signaling, #2880), acetyl‐FoxO1 (Santa Cruz, sc‐49437), p53 (Cell Signaling, #2524), acetyl‐p53 (Cell Signaling, #2570) and β‐actin (Abcam, ab8227). Membranes were treated with an enhanced chemiluminescence kit (Millipore) and were imaged with UVP Bio‐Imaging Systems. QuantiOne imaging software (Bio‐Rad) was used for quantitative analysis by evaluating the integrated optical density.
Quantione imaging software
Manufactured by Bio-Rad
Sourced in United States
QuantiOne is a software package designed for image analysis and quantification of Western blots, protein gels, and other gel-based assays. It provides tools for image capture, band/spot detection, and data analysis.
Automatically generated - may contain errors
Lab products found in correlation
Lc2000, by Thermo Fisher Scientific (2 mentions)
Enhanced chemiluminescence kit, by Merck Group (1 mentions)
Hydroxylated hif 1α, by Cell Signaling Technology (1 mentions)
Sirt1, by Cell Signaling Technology (1 mentions)
Acetyl foxo1, by Santa Cruz Biotechnology (1 mentions)
Acetyl p53, by Cell Signaling Technology (1 mentions)
Foxo1, by Cell Signaling Technology (1 mentions)
β actin, by Abcam (1 mentions)
Phosphor erk, by Cell Signaling Technology (1 mentions)
Sds page gel, by Beyotime (1 mentions)
Phosphor stat3, by Cell Signaling Technology (1 mentions)
Stat3, by Cell Signaling Technology (1 mentions)
Phospho akt, by Cell Signaling Technology (1 mentions)
Gel imaging equipment, by Bio-Rad (1 mentions)
Anti rabbit secondary antibody, by Merck Group (1 mentions)
Bicinchoninic acid (bca), by Thermo Fisher Scientific (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Ab6161, by Abcam (1 mentions)
Immobilon western hrp substrate luminol reagent, by Merck Group (1 mentions)
P0012ac, by Beyotime (1 mentions)
6 protocols using quantione imaging software
1
Protein Expression Analysis in Gastrocnemius and HUVECs
2
Western Blot Analysis of Stem Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Myocardium tissues and AD-MSCs were harvested for Western Blot following standard protocol. Samples consisting of 50 μg total protein were loaded onto an SDS-PAGE gel (Beyotime, China) and transferred electrophoretically to nitrocellulose membranes (LC2000, Invitrogen, USA). After blocked with 5% bovine serum albumin in PBS, the membranes were incubated with the appropriate primary antibody against Akt, phospho-Akt, ERK, phosphor-Erk, Stat3, phosphor- Stat3, all from Cell Signaling Technology, Danvers, MA,USA) overnight. The next day, the blots were washed and incubated in the appropriate secondary antibodies (Abcam, Cambridge, MA, USA) at room temperature for 1 h. Immunoreactivity was then detected by sequential incubation with HRP-conjugated antibodies and enzymatic chemiluminescence. Quantitative analysis was performed using QuantiOne imaging software (Bio-Rad, USA) to assess the integrated optical density (IOD) of each band.
3
Western Blot Analysis of Cellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total proteins were isolated from the cells with protein lysis buffer. The concentrations of the protein samples were determined by bicinchoninic acid (BCA; Thermo Scientific) protein assay. Proteins samples (40 μg) were run and separated on a 10% of SDS-polyacrylamide gel (SDS-PAGE), and then transferred onto PVDF membranes (Millipore, Billerica, MA, USA). After blocking in blocking buffer (1X TBST with 5% w/v de-fatted milk powder), the membranes were incubated with specific primary antibodies at 4°C overnight. Primary antibodies against Skp2 (1:1,000), ZO-1 (1:1,000), N-cadherin (1:1,000), E-cadherin (1:2,000), Slug (1:1,500), Vimentin (1:1,000), Nanog (1:1,000), Oct4 (1:1,500), ABCB1 (1:1,500), Foxo1 (1:1,500) and p21 (1:1,000) were used. The membranes were then washed with TBST and probed with anti-mouse (Cat. no. #A3682, 1:4,000, Sigma-Aldrich, St. Louis, MO, USA) or anti-rabbit secondary antibodies (cat. no. A16110 1:3,000, Thermo Fisher Scientific) at room temperature for 1 h. Finally, the membranes were washed again and detected using enhanced chemiluminescence substrate (ECL) (Sigma-Aldrich; EMD Millipore). Quantitative analysis was carried out using QuantiOne imaging software with gel imaging equipment (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
4
Western Blot Analysis of HLA-G Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methods of western blot analysis were described previously (28 (link)). Briefly, HTR-8/SVneo cells transfected with miRNAs were washed by PBS and lysed by RIPA lysis buffer. Samples consisting of 50 µg total protein were loaded onto an SDS-PAGE gel (P0012AC, Beyotime Biotechnology, China) and transferred electrophoretically to nitrocellulose membranes (LC2000, Invitrogen). After blocking with Tris-buffered saline with Tween-20 (TBST) containing 5% milk powder, the membranes were incubated with the appropriate primary antibody against HLA-G (MEM-G/1, ab7759; Abcam, Cambridge, UK, 1:500) or tubulin (ab6161, Abcam, Cambridge, UK, 1:2,000), anti-mouse IgG horseradish peroxidase (HRP)-conjugated secondary antibody (GE Healthcare, Piscataway, NJ, USA) was added for 1 h.
The blots were developed using Immobilon Western HRP Substrate Luminol Reagent (Millipore, Billerica, MA, USA). The quantification of HLA-G relative to tubulin expression within each sample was determined using the QuantiOne imaging software (Bio-Rad, USA).
The blots were developed using Immobilon Western HRP Substrate Luminol Reagent (Millipore, Billerica, MA, USA). The quantification of HLA-G relative to tubulin expression within each sample was determined using the QuantiOne imaging software (Bio-Rad, USA).
5
Quantitative RNA Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cytoplasmic RNA was prepared using commercial kits (RNAeasy kit, Qiagen, cat. no. 74104, or GeneJET RNA Purification kit, Thermo cat. no. #K0731) using manufacturer’s instructions. 1 μg (M-Mu-LV-Rtase, Roche) or 500 μg (New England BioLabs E6300L) RNA was used for each first strand cDNA synthesis reaction, as per instructions of the mentioned manufacturer, using random primers (Boehringer Mannheim). The amount of cDNA used was standardized using GAPDH and linear range determined. Typically the RT-PCR reactions were performed using 10–50 ng cDNA template in 25 μl reaction with BioTaq polymerase or 20 μl reaction with iTaq polymerase, at 50–64°C, as required, for 26–30 cycles. GAPDH primers (ADS1036/1037) were 5′ AGACAAGCTTCAGAGCCACCCGGGACC and 5′AGACTCTAGATCGGAGTCAACGGATTTGG; Pea3-specific primers (ADS1046/1047) were 5′ GACAAGCTTCGCCTACG ACTCAGATGTC and 5′ GACTCTAGAAGCTCCAATCCCTTCCTGC; Neurofilament-L primers were 5′ CAGTCTGGAGAACCTCGACC and 5′ TTCCAGGACCTTGTTCTGCT; Neurofilament-M primers were 5′AGGCATCGCACATCACGGTGGAG and GGATATTGTGATTGGGGGTCG. The products were resolved in 2.5 % Nu-Sieve agarose gels and were analyzed using QuantiOne imaging software (BioRad).
6
Western Blot Analysis of Myocardial Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Myocardium tissues were harvested for Western blot as described previously 12 . Cells of each group were harvested at appropriate time. Cells were washed three times with PBS and collected after ice-cold lysis buffer digestion. Protein lysates were separated on 12% SDS-PAGE gels and transferred onto nitrocellulose (NC) membrane. Membranes were blocked with 5% milk in 1×TBS-Tween-20 buffer and incubated overnight at 4°C with primary antibodies (dilution 1:2000 for anti-Akt, 1:1000 for anti-ERK1/2 (ERK, #4695), phospho-ERK1/2 (Ser473, #4370), phospho-FoxO3a (Thr32, #2599), Akt (#4685), phospho-Akt (#4060), ecSOD (#2920) and Tubulin (#4967), all from Cell Signaling Technology, Danvers, MA, USA), followed by incubation with the corresponding secondary antibodies at room temperature for 1 h. The signal was detected with ECL-Plus reagent. Nuclear and cytoplasmic fractions of the cells were isolated using Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime Biotechnology, Jiangsu, China). Immunoreactivity was detected by sequential incubation with HRP-conjugated antibodies and enzymatic chemiluminescence (#7003). Integrated optical density (IOD) of immunoblot was quantified using QuantiOne imaging software (Bio-Rad, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!