Bulge loop mirna rt primer

Total RNA from VSMCs or serum was isolated with TRIzol reagent (Takara, RNAiso Plus, 9108 and RNAiso Blood, 9112). Reverse transcription was performed using a PrimeScript RT Reagent Kit (Takara, RR037A), and qRT‐PCR of miR‐199a‐5p performed using a One‐Step TB Green^® PrimeScript^™ RT‐PCR Kit (Takara, RR820A). For miR‐199a‐5p, Bulge‐Loop^™ miRNA RT primer (RiboBio) was used. U6 was the reference gene for miRNA expression analysis. The expression of miR‐199a‐5p was normalized to the expression of U6 using the 2^−ΔΔCt cycle threshold method. The experiments were repeated at least three times.

Exosome-RNAs were isolated from exosomes with Trizol (Invitrogen, Carlsbad, CA, USA) according to the standard procedures and cel-miR-39 (RiboBio, China) was added to normalize the technical variation between samples. Tissue and cell RNAs were extracted with RNA-Quick Purification Kit for small RNA (ES Science, China) according to the protocols obtained from the manufacturers, and U6 (RiboBio, China) was used as the internal reference for miRNA. RNA concentrations were verified on the NanoDrop Spectrophotometer (Thermo Scientific, USA). Isolated RNA was reversely transcribed using miRNA primers (Bulge-LoopTM miRNA RT primer) and the riboSCRIPT Reverse Transcription Kit (RiboBio, China). qRT-PCR was performed on a Roche LightCycler 480°C System (Roche, Switzerland) using a TB Green Premix Ex Taq II Kit (Takara, Japan). Amplification was performed at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 20 s. All procedures were performed according to the protocols obtained from the manufacturers. Fold change in RNA species was calculated using formula 2^(−ΔΔCt). ΔΔCt = (Ct target miRNA–Ct control). The sequences were as follows:
miR-126a-3p 5′-UCGUACCGUGAGUAAUAAUGCG-3′
let-7c-5p 5′-UGAGGUAGUAGGUUGUAUGGUU-3′
let-7f-5p 5′-UGAGGUAGUAGAUUGUAUAGUU-3′
miR-203a-3p 5′-GUGAAAUGUUUAGGACCACUAG-3′
miR-144-3p 5′-UACAGUAUAGAUGAUGUACU-3′
miR-98-5p 5′-UGAGGUAGUAAGUUGUAUUGUU-3′.

Total RNA was extracted from cells using TRIzol reagent as previously described [29 (link)]. For mRNA detection, cDNA was synthesized from 1 μg of total RNA using an Oligo (dT) reverse transcription primer and a HiScript® III 1st Strand cDNA Synthesis kit (Vazyme, Nanjing, China). For miRNA detection, cDNA was generated using 1 μg of total RNA and a specific Bulge-Loop^TM miRNA RT primer (Ribobio). Quantitative polymerase chain reaction (qPCR) was performed using ChamQ SYBR qPCR Master Mix (Vazyme). Quantitation of the relative expression levels of the target genes was performed in triplicate and calculated using the 2^−ΔΔCT method. GAPDH and U6 [29 (link)–31 (link)] were used as endogenous controls to normalize mRNA and miRNA expression, respectively.

Total RNA (500 ng) was isolated from 1 × 10⁶ cells using Trizol reagent (Promega, USA). For hsa-miR-12462, Bulge-LoopTM miRNA RT primer was obtained from RiboBio Corporation (Guangzhou, China). miDETECT A Track miRNA qRT-PCR Starter Kit (RiboBio, China) was applied according to the manufacturer's instructions. For FosB, All-in-One First-Strand cDNA Synthesis Kit (GeneCopoeia, Rockville, USA) was applied to synthesize cDNA, and qPCR assay was carried out using Hieff qPCR SYBR^® Green Master Mix kit (Yeasen Biotech, Shanghai, China) with an Applied Biosystems Prism machine using ABI StepOnePlus (Applied Biosystems, Foster City, CA, USA). The primers of FosB were designed by GeneCopoeia Inc., China. The relative expression level of hsa-miR-12462 and FosB was normalized to U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), respectively, and calculated using the 2-ΔΔCT method.

For quantitative real‐time polymerase chain reaction (RT‐qPCR) analysis, RNA was reverse‐transcribed by using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Tokyo, Japan). For miRNA‐29a, Bulge‐Loop^TM miRNA RT primer (RiboBio, Guangzhou, China) was used. GADPH was used as the reference for H19 and TDG, and U6 was used as the reference for miRNA‐29a. The primers were as follows: H19 Forward TCTGAGAGATTCAAAGCCTCCAC, Reverse GTCTCCACAACTCCAACCAGTG; TDG Forward CAACAACTGATGGCTGAAGCTC, Reverse ACACTGCTATTCGTGGCTGA; GAPDH Forward CGGAGTCAACGGATTTGGTCGTAT, Reverse AGCCTTCTCCATGGTGGTGAAGAC. The relative abundance of RNA was calculated using the 2^−ΔΔCt method in Applied Biosystems PowerUp SYBR Green (Applied Biosystems, USA) on the ABI Step One Plus (Applied Biosystems, USA) according to the manufacturer's instructions.