The largest database of trusted experimental protocols

One step rt pcr kit

Manufactured by Accurate Biology
Sourced in China

The One Step RT-PCR Kit is a laboratory equipment designed for the reverse transcription and amplification of RNA in a single reaction. It enables the conversion of RNA to complementary DNA (cDNA) and the subsequent polymerase chain reaction (PCR) amplification in a streamlined workflow.

Automatically generated - may contain errors

3 protocols using one step rt pcr kit

1

Gene Expression Analysis in Osteoclasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded in 12-well plates (2 × 105 cells/well), and after 3–5 days of culture, total mRNA was extracted using TRIzol reagent (Invitrogen). Then, mRNA reverse transcription and RT-qPCR were performed according to the experimental procedure of One Step RT-PCR Kit (Accurate Biotechnology, AG11606). The sequences of the relevant primers are shown below:
GSTP1: F:5′- ATGCCACCATACACCATTGTC -3′, R:5′- GGGAGCTGCCCATACAGAC -3′;
NFATc1: F:5′-GACCCGGAGTTCGACTTCG -3′, R:5′-TGACACTAGGGGACACATAACTG -3′;
ACP5: F:5′- CACTCCCACCCTGAGATTTGT -3′, R:5′- CATCGTCTGCACGGTTCTG -3′;
c-Fos: F:5′- CGGGTTTCAACGCCGACTA -3′, R:5′- TTGGCACTAGAGACGGACAGA -3′;
CTSK: F:5′-GAAGAAGACTCACCAGAAGCAG -3′, R:5′-TCCAGGTTATGGGCAGAGATT -3′.
+ Open protocol
+ Expand
2

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted from cells using an RNA Extraction Kit (Accurate Biotechnology, Danyang, China). Total RNA was reverse-transcribed to cDNA using a one-step RT-PCR kit (Accurate Biotechnology, China). RT-qPCR was performed using SYBR Green (Accurate Biotechnology, China) in an RT-PCR machine (Agilent Technologies, Santa Clara, CA, USA). Values were normalized to GAPDH mRNA levels. The gene primer sequences used for qRT-PCR are listed in Table 1.
+ Open protocol
+ Expand
3

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from liver samples using One-step RT-PCR Kit (Accurate Biology, Hunan, China), according to the manufacturer’s protocol. Total RNA concentration was determined using NanoDrop One spectrophotometer (Thermo Fisher Scientific, United States). Then, 1 μg of total RNA was reverse-transcribed into cDNA using oligo-dT primers. qRT-PCR was performed to analyze gene expression using SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, Hunan, China). Transcriptional levels of the target genes were normalized against that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primers (Table 1) for target genes were designed using Oligo 7.0. Primer synthesis and qRT-PCR amplification reaction conditions were consistent with those reported in our previous study (Li et al., 2022 (link)).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!