Target specific primers

The human colorectal cancer cell line HCT116 was obtained from ATCC (CCL-247). Cells were maintained in McCoy's 5A Medium (Invitrogen) supplemented with 10% fetal bovine serum. Cultures were grown at 37°C in a humidified atmosphere containing 5% CO₂. Cells were treated with 5-FU (SIGMA) for 6 hrs at a final concentration of 375 µM. Whole cell extracts from HCT116 cells were subjected to Western analysis using the p53-specific antibody DO1 (sc-126, Santa Cruz). Quantitative PCR was performed on Rotor-Gene 3000 (Roche) using SYBR Green PCR Master Mix (Applied Biosystems), target-specific primers (Integrated DNA Technologies) and 2 µl ChIP DNA as a template. Enrichment in the ChIP samples at specific target sites was calculated as a fraction of the total Input (%).

The cDNA was synthesized from total RNA using SuperScript III reverse transcriptase (Thermo Fisher Scientific) with Oligo(dT)18 primer (Thermo Fisher Scientific), and analyzed by PCR using TaKaRa Ex Taq polymerase (Takara Bio) with target-specific primers (Integrated DNA Technologies, Coralville, IA, USA; Table S3). The PCR products were visualized by 2% agarose gel electrophoresis. The PCR products were further quantified by Applied Biosystems 7900HT Fast Real Time PCR System (Thermo Fisher Scientific) using THUNDERBIRD SYBR qPCR Mix (Toyobo).

Validation of the TSSs of three ‘near the transcription origin’ (NTO) transcripts, and the spliced isoforms of the region was carried out using targeted long-read sequencing. The cDNA library was prepared using the ONT 1D protocol, as described in the ‘Oxford Nanopore MinION cDNA sequencing and barcoding’ section, with the following modifications: we used ribodepletion instead of poly(A) selection, and target-specific primers (Integrated DNA Technologies) were applied instead of oligo(dT)-priming for the cDNA preparation. The target-specific primers used in this study are listed in Table 1.Table 1

target-specific primers used for the detection of NTO transcripts

Primer name	Sequence
pNTO2	ACTTGCCTGTCGCTCTATCTTCCGGTCAGGATCT
pNTO3	ACTTGCCTGTCGCTCTATCTTCGTACTGTTGGAACT
pNTO4	ACTTGCCTGTCGCTCTATCTTCATGTGAGACAACC
pNTO1_3’	ACTTGCCTGTCGCTCTATCTTCTCGTGTCGACG
pNTO1-ex2	ACTTGCCTGTCGCTCTATCTTCCTCGACGCTG

The primers are composed of a sequence complementary to the MinION cDNA adapter and a target-specific sequence (in italics)