Sybr green premix

RNA samples were prepared with the RNAprep Pure Plant Kit (TIANGEN, Beijing, China), and cDNA was prepared with the FastQuant RT Kit (TIANGEN, Beijing, China). The semi-quantitative PCR was used to detect the expression of BdCIPK31 in different transgenic tobacco lines. The Nicotiana tabacum ubiquitin gene was employed as endogenous control. The qRT-PCR analysis was applied with the SYBR Green PreMix (TIANGEN, Beijing, China) and the CFX96^TM Real-Time Detection System (Bio-Rad, United States). The Brachypodium β-actin gene and the N. tabacum ubiquitin gene were employed as endogenous controls. All primers applied in these assays are listed in Supplementary Table S2. The 2^-ΔΔCt method was used to analyze the qRT-PCR results.

Small RNAs were isolatied with the miRcute miRNA kit (Tiangen Inc. Beijing. China, DP501) and the first-strand cDNA was synthesized using the miRcute miRNA First Strand cDNA Synthesis kit (Tiangen Inc. Beijing. China, KR201) following the manufacturer’s instructions. Real-time PCR analysis was conducted using BioRad CFX 96 with SYBR Green Premix (Tiangen Inc. Beijing. China, FP401). The wheat gene U6 was used as the internal reference gene. The mean of three technical replicates was taken as the expression level of one biological replicate. Student’s t-test was used to analyze the expression data, and P-values of < 0.01 or 0.05 were considered statistically significant. The tRF-specific forward primers are listed in S4 Table. The specificity of the PCR assays for tRFs was detected using gel electrophoresis (S1 Fig).

The expression levels of classical toxicity biomarker genes fabp10a, gclc, gsr, nqo1, gfap, and erg in 48 hpf embryonic zebrafish exposed to gradient mitoxantrone (0, 10, 50, and 100 μg/L) were analyzed with gapdh as internal control. The primers (Table 5) were designed and synthesized as described in Section 2.4. All reaction systems (25 μL) were as follows: 12.5 μL of SYBR Green Premix (Tiangen, Beijing, China), 2 μL of cDNA template, and 0.5 μM primer forward/reverse. Up to 25 μLof MilliQ water was added. The reaction procedure was as follows: 95 °C for 15 min; 95 °C for 10 s, and 60 °C for 30 s. 35 cycles. 65–95 °C with increments of 0.5 °C every 5 s for melt curve. Quantification cycle (Cq) cutoffs of 35 were applied. All reactions were carried out in triplicates.

qRT‐PCR was performed as described previously.¹⁵ Total RNA was isolated from tumor tissues by TRIzol reagent (15596026; Invitrogen). FastKing‐RT SuperMix kit (KR118; TIANGEN) was used to synthesize first‐strand complementary DNA from 1.5 μg total RNA. qRT‐PCR analysis was carried out using an Eppendorf system (Realplex) with SYBR Green PreMix (FP209; TIANGEN) in the amplification reaction mixtures (25 μl). The primer sequences were: OPN3: 5′‐CAATCCAGTGATTTATGTCTTCATGATCAGAAAG‐3′ (forward); 5′‐GCATTTCACTTCCAGCTGCTGGTAGGT‐3′ (reverse); glyceraldehyde 3‐phosphate dehydrogenase: 5′‐GACATCCGCAAAGACCTG‐3′ (forward), 5′‐GGAAGGTGGACAGCGAG‐3′ (reverse). The reaction was taken by pre‐degeneration at 95°C for 10 min, 40 cycles at 95°C for 15 s, 60°C for 1 min. Relative messenger RNA (mRNA) level was calculated using the 2^−∆CT method.

The total RNA of each sample was measured by a nucleic acid‐protein analyser and then reverse‐transcribed to cDNA by a reverse‐transcription kit (Tiangen) according to the manufacturer's instructions. qRT‐PCR was performed using SYBR Green premix (Tiangen) in a LightCycler 96 apparatus (Roche, Basel, Switzerland). Amplification was performed for 600 s at 95°C, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. 18S rRNA acted as an internal control. Three parallel replicates were performed for each sample. The relative expression levels of the lncRNAs LINC01128, MIAT, CYTOR, ZEB1‐AS1, FRMD6‐AS2, NNT‐AS1, LINC00240, EBLN3P, PANDAR, IRF1, LINC00466, SEMA3B‐AS1, KRT7‐AS, HCG18 and LINC00163 were normalized to that of 18S rRNA within each sample using the 2^−ΔΔCt method. Primers designed for validation are shown in Table S1.

Total RNA extracted from cells by TRIzol reagent was subsequently reverse transcribed into cDNA by reverse transcription kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the instruction of the manufacturer. The quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the SYBR Green premix (Tiangen) in a LightCycler 96 apparatus (Roche, Basel, Switzerland). 18S rRNA acts as an internal control. Reactions were performed in duplicate for each sample. Data were normalized as the ratio of lncRNA transcript to 18S rRNA transcript. The relative expression level was calculated by the delta-delta-Ct method. Primers designed for validation were synthesized by Sangon (Sangon Biotech, Shanghai, China) and shown in Table 1.