5 brom 4 chloro 3 indolyl phosphate substrate

Chromogenic miRNA ISH was performed essentially as described previously [14] using a Tecan Evo automated hybridization instrument (Tecan, Männedorf, Switzerland). The following steps were performed on 5 μm-thick sections: predigestion with proteinase-K (10 μg/ml) at 37 °C for 8 min, prehybridization at 55 °C for 15 min, incubation with double-carboxyfluorescein (FAM)-labeled locked nucleic acid (LNA) probes (Exiqon, Vedbeak, Denmark) [15] for miR-143-3p (GAGCTACAGTGCTTCATCTCA; predicted RNA Tm, 85 °C), miR-145-5p (AGGGATTCCTGGG AAAACTGGAC; predicted RNA Tm, 84 °C), and miR-375 (TCACGCGAGCCGAACGAACAAA; predicted RNA Tm, 82 °C) at 20-40 nM in Exiqon hybridization buffer (Exiqon) for 2 h at 55 °C, stringent washes with saline-sodium-citrate (SSC) buffers, detection of the FAMlabeled probes with alkaline phosphatase-conjugated sheep anti-FAM Fab fragments (Roche, Basel, Switzerland), incubation with 4-nitro-blue tetrazolium and 5-brom-4chloro-3′-Indolyl-phosphate substrate (Roche) for 1 h to allow the development of the dark-blue diformazan precipitate at the location of the bound probe, and finally, counterstaining with nuclear fast red. The slides were then dehydrated and mounted. The slides were processed in an AxioScan slide scanner (Zeiss, Oberkochen, Germany) and image acquisition was accomplished using the Zen software (Zeiss).