To explore the methylation modification of Thbs1 promoter, we obtained the nucleotide sequence of Thbs1 promoter region from Ensembl database with the ID number ENSMUSG00000040152. A 260bp region and a 147bp region of CpG island in Thbs1 promoter was predicted in website “http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ”. The 260bp region located at chromosome 2: 117,942,070–117,942,330, with 19 CpG dinucleotides. The 147bp region located at chromosome 2: 117,942,405–117,942,552, with 12 CpG dinucleotides. We isolated the Lineage negative population by using Lineage Depletion Kit (Miltenyi Biotec). Genomic DNAs from Lineage negative cells were isolated by using Genomic DNA extraction Kit (ThermoFisher) and converted the unmethylated cytosines to uracils by using Epitect Bisulfite Kits (Qiagen). To amplify the CpG island region, we use Platinum II Taq Hot-Start DNA Polymerase (ThermoFisher) and follow the commercial protocol to conduct the PCR assay. For 260bp region, the forward primer is TTTTAGGTGGTTTTTAAAGAAGTAT, and the reverse primer is TAAAAAAACAAAAAACAAAAAAAA. For 147bp region, the forward primer is TTTAGTTAAGTTAGTTATTGTTTGGAGTTA, and the reverse primer is CTAATCATCTACAACCTAAAACTTTAAAAT. Then the amplified fragments were ligated to pCR 2.1-TOPO TA vector and conducted transformation. Three positive colonies were selected to extract plasmid and sequenced.
Platinum 2 taq hot start dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States
Platinum II Taq Hot-Start DNA Polymerase is a recombinant Taq DNA polymerase enzyme that is chemically modified to provide hot-start functionality. It is designed for high-performance PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Lineage depletion kit, by Miltenyi Biotec (2 mentions)
Epitect bisulfite kit, by Qiagen (2 mentions)
Genomic dna extraction kit, by Thermo Fisher Scientific (2 mentions)
Direct zol rna miniprep kit, by Zymo Research (2 mentions)
Cpgenome universal dna modification kit, by Merck Group (2 mentions)
Ta cloning kit, by Thermo Fisher Scientific (2 mentions)
One shot top10 chemically competent e coli cells, by Thermo Fisher Scientific (2 mentions)
Quick dna miniprep plus kit, by Zymo Research (2 mentions)
Zyppy plasmid miniprep kit, by Zymo Research (2 mentions)
Bta mir 15a, by RiboBio (2 mentions)
Bta mir 15b, by RiboBio (2 mentions)
Bta mir 16a, by RiboBio (2 mentions)
Bta mir 16b, by RiboBio (2 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Faststart sybr green master, by Roche (1 mentions)
Rotor gene q real time pcr system, by Qiagen (1 mentions)
Itaq dna polymerase, by Bio-Rad (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Ssoadvanced preamp supermix, by Bio-Rad (1 mentions)
Rnaprotect, by Qiagen (1 mentions)
19 protocols using platinum 2 taq hot start dna polymerase
1
Methylation Analysis of Thbs1 Promoter
2
Quantitative RT-PCR Analysis of Oxidative Stress Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell stored in TRIzol was isolated using Direct-zol™ RNA Miniprep Kit (Zymo Research, Irvine, CA, USA) and transcribed using Transcriptor First Strand cDNA Synthesis Kit with anchored dT primers (Roche Applied Science, Indianopolis, IN, USA) according to the manufacturers’ recommendations. Quantitative RT-PCR was performed using TaqMan assays for NOX3 (Hs01098883_m1), NOX4 (Hs01379108_m1), GPX2 (Hs01591589_m1, all Thermo Fisher Scientific, MA, USA), GPX3 (Hs01078668_m1) using Platinum II Taq HotStart DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) as reported previously [31 (link)]. Expression of NOX1, NOX2, SOD1, SOD2, SOD3, CAT, GPX1, GPX4, and MPO genes were assessed using the FastStart SYBR Green Master (Roche Applied Sciences, Indianopolis, IN, USA) as reported previously [32 (link)]; for primer sequences, see Table 1 (Integrated DNA Technologies, Coralville, IA, USA). A human universal reference RNA (Stratagene, La Jolla, CA, USA) was used as a calibrator and target gene expression was normalized to the housekeeping gene PSMB2 [33 (link)]. RT-PCR was performed on a Rotor-Gene Q real-time PCR system (Qiagen, Germantown, MD, USA), relative mRNA expression levels were calculated by the second derivative method (Rotor-Gene Software 6.1.81, Qiagen, Germantown, MD, USA), as described previously [31 (link),32 (link),33 (link)].
3
RNA Extraction and qPCR Analysis of S. aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. aureus SH1000 was cultured overnight, spun down, and the pellet was treated with RNAprotect (Qiagen, Hilden, Germany). TRIzol reagent was added, and the pellet was resuspended and transferred to a bead-beating tube for lysis using the same procedures as for the tape strips described earlier. Total RNA extraction was performed with the Direct-zol RNA Miniprep Kit (Zymo Research), and DNase treatment was done with the TURBO DNA-free Kit (Invitrogen) as per the manufacturer’s instructions. After cDNA synthesis, preamplification was performed using the iTaq DNA polymerase (Bio-Rad Laboratories), SsoAdvanced PreAmp Supermix (Bio-Rad Laboratories), or Platinum II Taq Hot-Start DNA polymerase (Thermo Fisher Scientific) according to the manufacturer’s instructions for 20 cycles. qPCR was performed for gmk, gyrA, fnbpA, and sspB. To determine the amplification bias, qPCR was performed directly using the cDNA without further preamplification for the same genes. The amplification bias is calculated by first subtracting the CT value of the preamplified sample from that of the unamplified sample and then subtracting the theoretical CT difference with accounting for sample dilution.
4
Methylation Analysis of Thbs1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To explore the methylation modification of Thbs1 promoter, we obtained the nucleotide sequence of Thbs1 promoter region from Ensembl database with the ID number ENSMUSG00000040152. A 260bp region and a 147bp region of CpG island in Thbs1 promoter was predicted in website “http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ”. The 260bp region located at chromosome 2: 117,942,070–117,942,330, with 19 CpG dinucleotides. The 147bp region located at chromosome 2: 117,942,405–117,942,552, with 12 CpG dinucleotides. We isolated the Lineage negative population by using Lineage Depletion Kit (Miltenyi Biotec). Genomic DNAs from Lineage negative cells were isolated by using Genomic DNA extraction Kit (ThermoFisher) and converted the unmethylated cytosines to uracils by using Epitect Bisulfite Kits (Qiagen). To amplify the CpG island region, we use Platinum II Taq Hot-Start DNA Polymerase (ThermoFisher) and follow the commercial protocol to conduct the PCR assay. For 260bp region, the forward primer is TTTTAGGTGGTTTTTAAAGAAGTAT, and the reverse primer is TAAAAAAACAAAAAACAAAAAAAA. For 147bp region, the forward primer is TTTAGTTAAGTTAGTTATTGTTTGGAGTTA, and the reverse primer is CTAATCATCTACAACCTAAAACTTTAAAAT. Then the amplified fragments were ligated to pCR 2.1-TOPO TA vector and conducted transformation. Three positive colonies were selected to extract plasmid and sequenced.
5
Bacterial 16S rRNA Quantification and Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Copy numbers of bacterial 16S rRNA genes were quantified in nucleic acid extracts by a quantitative real-time PCR protocol, as described before [36 (link)], and were normalized to 1e+6 copies per mL. Subsequently, V1 to V3 hypervariable regions of bacterial 16S rRNA genes were amplified from a total of 1e+7 bacterial 16S rDNA copies with primer S-D-Bact-0008-c-S-20 containing a 10-bp barcode sequence and IonTorrent-specific sequencing adaptor A, and S-D-Bact-0517-a-A-18 containing a 3’-P1 adapter sequence using the Platinum II Taq Hot-Start DNA Polymerase (Thermo Fisher Scientific). After 30 PCR cycles, amplicons were purified twice with a 0.8 bead to DNA ratio using MagSi-NGSPREP Plus beads (Steinbrenner Laborsysteme, Wiesenbach, Germany). Copy numbers of amplicons containing sequencing-adaptors were determined using the KAPA Library Quantification IonTorrent Kit (Roche Diagnostics) and pooled to equimolar amplicon concentrations of each sample. A total of 120 attomol of the final library pool was subjected to isothermal amplification with the Ion PGM™ Template IA 500 Kit before running 1100 flow cycles during high-throughput sequencing on an Ion Torrent™ S5 Plus machine (Thermo Fisher Scientific).
6
Complete Genome Amplification and Sequencing of PCV2 and PCV3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCV2 (23 (link)) and PCV3 (20 (link)) complete genomes were amplified using the primers described previously. The reaction system was 50 μL, containing 25 μL of 2 × Platinum™ II Taq Hot-Start DNA Polymerase (Thermo Scientific, USA), 2 μL of template DNA, 200 nM primers, and the remaining was added to ddH2O. The PCR reaction for PCV2 was executed by pre-denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 15 s, 56°C for 15 s, and 68°C for 20 s. PCV3 amplification conditions were similar to those of PCV2, except that the PCV3 primer set was annealed at 57°C. The purified PCR products were cloned using a pMD18-T vector cloning kit (Takara, Dalian, China), and propagated in DH5α competent cells (Takara, Dalian, China) according to the manufacturer’s instructions. Positive clones were sequenced by Beijing Tsingke Biotech Co., Ltd. The obtained complete genome sequences were edited and assembled using DNAstar V7.1 software.
7
Validation of Novel Isoforms and Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
New isoform and gene validations were conducted using gel PCR. For this purpose, 2ug of RNA was transcribed into cDNA using the High-Capacity cDNA Reverse Transcription kit (AB Applied Biosystems, catalogue number: 4368814) following the published protocol. The resulting cDNA was quantified using a nanodrop, and its quality was assessed using the Agilent Fragment analyzer 5200 with the DNA (50kb) kit (Agilent, DNF-467). Next, 500ng of the cDNA was combined with primers specific to the newly identified isoforms and genes (Supplementary Table 6 ). The amplification was performed using Invitrogen Platinum II Taq Hot start DNA Polymerase (Invitrogen 14966–005) in the Applied Biosystem ProFlex PCR system. The specific primer sequences, annealing temperatures, and the number of PCR cycles are detailed in Supplementary Table 6 . After the PCR amplification, the resulting products were analyzed on a 1% agarose TAE gel containing 0.5ug/ml ethidium bromide. The gel was run for 30 minutes at 125v, and the amplified DNA was visualized using a UV light source. Gels from PCR validation for each transcript can be found in Supplementary Fig. 1 –10 .
8
Identifying Plasmid Insertion Site
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The site on the plasmid with the random insertion was confirmed by RESDA-PCR43 (link). The PCR conditions were as described in the Kong and Li-Beisson44 . The 1st PCR was amplified in a 20 µL volume using Taq DNA polymerase (Biofact, Korea) with degenerate primers and pEtt-F1 primers. The 2nd PCR was carried out in a 20 µL volume using Platinum II Taq Hot-Start DNA polymerase (Invitrogen, USA). The Q0 and pEtt-F2 primers were used for amplification in the 2nd PCR. The final PCR product was separated on a 1% agarose gel at 100 V for 30 min using electrophoresis. The amplified band was extracted by Wizard SV gel and a PCR clean-up system (Promega, USA). PCR fragments were cloned using the All in One PCR Cloning Kit (Biofact, Korea), cultured in LB medium with kanamycin and ampicillin (final conc. 50 µg mL−1), and sequenced with M13 universal primers.
9
Methylation Analysis of IRF8 Promoter
10
EGFL7 Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol™ (InvitrogenTM) and reverse-transcribed into cDNA using PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa). Specific EGFL7 transcripts were amplified using Platinum™ II Taq Hot-Start DNA Polymerase (Invitrogen™) and specific primers (forward: 5’-CTA GGG TCC ATC TCC AGT CC-3’; reverse: 5’-CCA ACA CCA GAA GCC ACA TCA G-3’) according to manufactory’s guide. Secondary PCR was done with resulting production. The presence of specific EGFL7 transcripts was presented by DNA Electrophoresis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!