RT-qPCR was performed following the guidelines of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) [32 (link)]. Each reaction was performed in 10 μL reactions including 2 μL of a 1:30 dilution of cDNA template, 2 μM of each primer, and 5 μL of SYBR Green (Takara). Amplified signals were monitored continuously with the Rotor Gene 3000 Real-Time Thermal Cycler (Qiagen). The amplification protocol was as follows: 5 min of denaturation and enzyme activation at 95°C, followed by 40 cycles at 95°C for 15 s, 55°C for 20 s, and 72°C for 15 s. Three biological replicates for each sample, and four technical replicates of each biological replicate, were used.
Rotor gene 3000 real time thermal cycler
Manufactured by Qiagen
Sourced in Australia
The Rotor-Gene 3000 Real-Time Thermal Cycler is a laboratory instrument designed for nucleic acid amplification and detection. It features a high-performance, temperature-controlled rotor for efficient thermal cycling of samples. The Rotor-Gene 3000 enables real-time monitoring of the amplification process, providing users with data for quantitative analysis.
Automatically generated - may contain errors
Lab products found in correlation
Fast start sybr green kit, by Roche (3 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Quantitect sybr green pcr kit, by Qiagen (2 mentions)
Rnaqueous 96 isolation kit, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Takara Bio (1 mentions)
Retroscript kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Taq man gene expression assays, by Thermo Fisher Scientific (1 mentions)
6 protocols using rotor gene 3000 real time thermal cycler
1
MIQE-Compliant RT-qPCR Quantification
2
Quantitative RT-PCR Analysis of Glycosylation Genes
3
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was isolated with TRIZOL (Invitrogen (Burlington, On, Canada) according to the manufacturer guidelines. 250 ng of mRNA was subjected to reverse transcription using the QuantiTect Reverse Transcription Kit. Quantitative PCR amplifications were performed using the QuantiTect SYBR Green PCR Kit in a Rotor-Gene 3000 Real-Time Thermal Cycler (Corbett Research, Sydney, Australia). For each gene tested, 35 amplification cycles at 59° C (annealing) were used. The primer sequences are summarized in Supplementary Table 1 . Relative gene expression was evaluated using 3 reference genes: HPRT1, Ppia and H2afz [56 (link)]. Relative gene expression was calculated using the delta-delta CT method [57 (link)].
4
Quantitative Transcript Analysis of SeV N
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were extracted using the RNAqueous-96 Isolation Kit (Ambion) and quantified. Reverse transcription was performed using 1 μg total RNA using the Quantitect reverse Transcription kit (Qiagen). Specific mRNA levels were quantified by qPCR using Fast start SYBR Green Kit (Roche) for SeV N (S: agtatgggaggaccacagaatgg, AS: ccttcaccaacacaatccagacc). A reaction without RT and a reaction with H2O were performed with each run to ensure absence of genomic DNA contamination. Fluorescence was collected using the Rotor-Gene 3000 Real Time Thermal Cycler (Corbett Research). Results were analyzed by the ΔΔCT method after normalization to S9 mRNA levels (S: cgtctcgaccaagagctga, AS: ggtccttctcatcaagcgtc).
5
Quantifying NOX/DUOX Isoforms in Breast Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from MCF-7 and ZR75.1 cells was prepared using the RNAqueous-96 Isolation Kit (Ambion). Total RNA from primary breast tumors was prepared as described in [37 (link)]. Total RNA was subjected to reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative PCR amplifications of IKKε, NOX2, NOX5, S9 and β-actin genes were performed using the Fast start SYBR Green Kit (Roche) in a Rotor-Gene 3000 Real-Time Thermal Cycler (Corbett Research). Absence of genomic DNA contamination was analyzed using a reaction without reverse transcriptase. Gene expression normalized over actin or S9 was analyzed using the ΔΔ Cycle threshold (Ct) method [38] (link) or as absolute mRNA copy numbers using plasmid-based standard curves as described in [39] (link). RT-PCR analysis of NOX/DUOX isoforms expression was performed as previously described [35] (link). Positive controls were used for each gene, as follows: total RNA from colon was used for NOX1; total RNA from DMSO-differentiated HL60 was used for NOX2; total RNA from human fetal kidney was used for NOX3; total RNA from MRC-5 were used for NOX4; total RNA from human spleen was used for NOX5; total RNA from human thyroid was used for DUOX1 and DUOX2. Human thyroid total RNA, human fetal kidney total RNA, human colon total RNA, and human spleen total RNA were purchased from BD Clontech.
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using the RNAqueous-96 Isolation Kit (Invitrogen-Thermo Fisher, Carlsbad, CA, USA) following the manufacturer’s instructions. Total RNA (1 µg) was subjected to reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen, Toronto, ON, Canada). Quantitative PCR were performed using either Fast start SYBR Green Kit (Roche, Indianapolis, IN, USA) for MX1, IDO, APOBEC3G, CXCL10, NOD2, PKR, IRF1, IFIT1 and IL8 or TaqMan Gene Expression Assays (Life Technologies-Thermo Fisher) for DUOX2, IFI27, SERPINB2, IL33, CCL20, ISG20. Sequences of oligonucleotides and probes used in PCR reactions are described in Supplemental Table S4 . Data collection was performed on a Rotor-Gene 3000 Real Time Thermal Cycler (Corbett Research, Mortlake, Australia). Gene inductions were normalized over S9 levels, measured using Fast start SYBR Green Kit or TaqMan probe as necessary. Fold induction of genes was determined using the ΔΔCt method [19 (link)]. All qRT-PCR data are presented as the mean ± standard error of the mean (SEM).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!