Mycycler thermal cycler

The effect of sacubitrilat and SAHA on the expression of epigenetic regulators (HDACs) was elucidated in SW-480 cells by performing the qRT-PCR. The SW-480 cells were grown to 70% confluency and treated with sacubitrilat and SAHA at IC₅₀ concentration. The protocol for measuring the expression of mRNA was carried out as per the earlier reported method^{74 (link)}. In brief, total RNA from control and treated samples were isolated using TRIZOL (Invitrogen USA) reagent. The obtained RNA samples were reconstituted in nuclease-free water and were quantified using SpectroStar-NanoBMG, Labtech. The cDNA reverse transcription kit (iScript, Biorad) was used for the synthesis of cDNA from total isolated RNA as per the manufacturer's protocol. The temperature profile was 25 °C for 5 min, 46 °C for 20 min, and 95 °C for 5 min were used for the reverse transcription using Mycycler Thermal Cycler, Biorad. The synthesized cDNA was used for real-time PCR using SYBR green (CFX96 Real-time System, Biorad) along with HDACs and GAPDH-specific primers. The GAPDH housekeeping gene was used for the data normalization. Fold changes in the mRNA expression levels of epigenetic regulators were analyzed using the 2^−ΔΔCT method^{75 (link)}.

Urease (ureC) genes were amplified with the modified primer set, UreC-F 5′-barcode-TGGGCCTTAAAATHCAYGARGAYTGGG-3′ and UreC-R 5′-GGTGGTGGCACACCATNANCATRTC-3′ (Reed, 2001 (link)), where the barcode is an eight-base sequence unique to each sample. Reactions were performed in a MyCycler Thermal Cycler (Bio-Rad, USA) using a 50 μL mixture containing 5 μL 10 × PCR buffer (Invitrogen, Carlsbad, CA, USA), 1.5 μL MgCl₂ (50 mM), 1 μL dNTP mixture (10 mM), 1.5 μL each forward and reverse primer (10 μM), 0.4 μL Platinum Taq DNA polymerase (Invitrogen), 2 μL rumen microbial DNA (100 ng μL^-1), and 37.1 μL sterile ddH₂O. PCR amplification began with a 5 min denaturing step at 94°C, followed by 30 cycles at 94°C for 30 s, 50°C for 30 s, and 72 °C for 30 s; extension was achieved at 72°C for 15 min. PCR amplicons of approximately 324 bp were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union, CA, USA) according to the manufacturer’s instructions and quantified using QuantiFluor^TM-ST (Promega US, Madison, WI, USA). Purified amplicons were pooled in equimolar and paired-end sequenced (2 × 300) on an Illumina MiSeq platform according to the standard protocols.

We designed a pair of primers (Forward primer 63 F: 5'-GAC GTT CGT GCT CTG CAT TA-3', Reverse primer 1347R: 5'-GAG CGA TGA TGA TCC GAA AT-3') based on the An. sinensis sodium channel gene sequence (GenBank accession: DQ334052) to amplify a 1285 bp fragment that encompasses the kdr target codon position L1014, an upstream intron (intron-1) and a downstream intron (intron-2). Both primers are located in the coding region. Two internal primers, 566 F (5'-CAC TGC TGT AAA ACC CTG TGT-3') and 855R (5'-CTG TTT GCT AGG CAG TTT GC-3') were used for sequencing. We amplified the 1285 bp fragment from individual specimen and a total of 273 specimens were examined. Reaction mix consisted of 10.5 μl 2X SYBR® Green PCR Master Mix (Thermo Fisher Scientific Inc., Waltham, MA, USA), 1 μl of template DNA (5–20 ng), 0.5 μl of 10 μM each primer, and 8.5 μl water. PCR cycles involved an initial denaturing step at 95 °C for 3 min, 35 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min, followed by an additional extension step at 72 °C for 6 min. Amplifications were performed in a Bio-Rad MyCycler Thermal Cycler. Products of PCR were visualised on 1 % agarose gel and then purified and sequenced from both ends with ABI Big Dye Terminator Cycle Sequencing Kit.

DNA was extracted from four dried colonies, using the NucleoSpin^® Plant II kit (Macherey-Nagel, Düren, Germany) following the protocol optimized for fungi. Internal Transcribed Spacer (ITS) and Large SubUnit (LSU) amplifications were performed using BioMix™ (BioLine GmbH, Luckenwalde, Germany), by adding 1 μL (5 pM) of each primer to 0.1 ng of template DNA, making it up to a final volume of 25 μL using distilled water. The amplification was carried out using MyCycler™ Thermal Cycler (Bio-Rad Laboratories GmbH, Munich, Germany) equipped with a heated lid.
The rRNA genes were amplified as follows: for the ITS region, the first denaturation step (2 min at 95 °C) was followed by denaturation for 30 s at 95 °C, annealing for 30 s at 55 °C, and extension for 30 s at 72 °C. For the LSU region, the first denaturation step (3 min at 95 °C) was followed by denaturation for 45 s at 95 °C, annealing for 30 s at 52 °C, and extension for 3 min at 72 °C. These last three steps were carried out 35 more times, with an additional final extension for 5 min at 72 °C for ITS and 7 min at 72 °C for LSU. Primers ITS5 and ITS4 [33 ], and LR5 and LR7 [34 (link)] were used to amplify ITS and LSU rDNA portions, respectively. Band intensity was determined and compared using ImageJ software Version 2 (https://imagej.nih.gov/ij/download.html) [35 (link)].

The primers used to amplify the gene of serotype 1 MDV-1 were designed as a sequence published by Handberg et al. [14 (link)]. The PCR was performed by amplifying the conserved ICP4 gallid herpesvirus-2 gene using the primer sequences, MDV-1.1 5’ GGATCGCCCACCACGATTACTACC 3’ and MDV-1.8 5’ ACT GCC TCA CAC AAC CTC ATC TCC 3’. The PCR reaction was performed in a final volume of 20 µl including 4 µl of nuclease water, 10 µl of 1x MasterMix Vivantis^®, 2 µl of template, and 2 µl of each 1 µM of forward and reverse primer. The amplification was done using MyCycler^™ Thermal Cycler (Bio-Rad, USA). A protocol by Abdel-Latif and Khalafalla [13 ] was used with minor modifications. Briefly, the protocol was set as follows: Initial denaturation at 95°C for 1 min, followed by 31 cycles of denaturation at 95°C for 1 min, annealing at 55°C for 10 s, extension at 72°C for 2 min for each cycle, and a final extension at 72°C for 4 min. The PCR products were analyzed by separating the products by gel electrophoresis in 1.5% agarose gel containing Midori Green. Finally, the gel was analyzed using GelDoc^™ EZ Imager (Bio-Rad, USA).