Gen amp pcr system 2400

The entire region of the rDNA of the mushroom sample denoted LUB approximately 670 bp was amplified by PCR using primers ITS 1 (TCCGTAGGTGAACCTGCGG) and ITS 4 (TCCTCCGCTTATTGATATGC). The reaction mix was made up of a total volume of 25 μl, composed of 23 μl of Taq polymerase “Ready to Go” mixture (Pharmacia, Sweden) with 0.2 μl of each primer (100 pM) and 2 μl of DNA template solution. The following thermocycling conditions was used for PCR reaction on a GenAmp PCR System 2400, Perkin-Elmer, USA: 30 cycles of denaturation at 95°C for 30 s; annealing at 50°C for 1 min; and extension at 72°C for 1 min. The amplification products were gel purified and electrophoresed on ethidium-stained agarose gel (0.7%). DNA sequencing was performed using the same primer pair as used previously (ITS 1and ITS 4) in an Applied Biosystem DNA Analyzer (USA).

Total RNA extracted from macrophages (TRI reagent; Sigma) was reverse transcribed using Revert Aid M-MuLV reverse transcriptase (Fermentas) and semi-quantitative polymerase chain reaction (PCR) was performed using Perkin Elmer Gen Amp PCR system 2400. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin were used as reference. Sequences of the PCR primers are listed in Table 1. The reaction conditions consisted of an initial activation step (5 min at 95°C) and cycling step (denaturation for 30 s at 94°C, annealing for 30 s at 58°C, and extension for 1 min at 72°C for 35 cycles). PCR amplified product was subsequently size fractioned on 2% agarose gel, stained with ethidium bromide and visualized under UV-light.

RNA was isolated according to the standard protocol [61 (link)]. Briefly total RNA extracted using TRIZOL^TM reagent (SIGMA). Isolated total RNA was then reverse transcribed using Revert Aid^TM M-MuLV Reverse Transcriptase (Fermentas). PCR amplification of the cDNA was conducted in a reaction volume of 20 μl using a Perkin Elmer Gen Amp PCR system 2400 and 0.5 unit of Taq polymerase set for 35 cycles. PCR amplified product was subsequently size fractioned on 1.5% agarose gel, stained with Ethidium Bromide and visualized under UV-light, the mRNA expression were compared, and normalized to GAPDH. The primer sequences are listed in Table 1.