Daf 2 da
DAF-2 DA is a fluorescent indicator for detecting nitric oxide (NO) in biological systems. It is a cell-permeable, non-fluorescent compound that becomes fluorescent upon reaction with NO. DAF-2 DA is commonly used in research applications to measure NO levels in cells, tissues, and other biological samples.
Lab products found in correlation
8 protocols using daf 2 da
Quantifying Nitric Oxide in Hemocytes and Salivary Glands
Visualizing RBC-derived Nitric Oxide
Fluorescent Imaging of NO in CMECs
Quantification of Nitric Oxide in Red Blood Cells
Multiparametric Analysis of Cellular Stress
Quantification of Endothelial Nitric Oxide
Quantification of iNOS Expression and NO Production in MDSCs
iNOS: 5′- CAGCGGGATGACTTTCCAAG AGGCAAGATTTGGACCTGCA-3′
Gene expression was assessed by using the 2−∆Ct method. Expression level of the target genes was calculated by normalization to the reference gene - hypoxanthine-guanine phosphoribosyltransferase (HPRT). To detect NO production by MDSCs, a 4.5-diaminofluorescein-2/diacetate (DAF-2/DA, Abcam, Cambridge, UK) was used according to Strijdom et al. [18] (link) and the cells were analyzed by flow cytometry (FACSCanto, BD Biosciences).
Erythrocyte Nitric Oxide Detection
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!