For gene expression, cells were collected at day 7 (MSCs) or 14 (HPAs) of differentiation and total RNA was extracted using the High Pure RNA Isolation kit (Roche Diagnostics, Switzerland). For tissues, mRNA was extracted using the FavorPrep™ Tissue Total RNA Purification Mini Kit (Favorgen Biotech Corp., Ping-Tung, Taiwan) and Qiagen RNeasy Lipid Kit (Qiagen, Hilden, Germany). For real-time PCR analysis, RNA was reverse transcribed and the HPRT or GAPDH gene was used to standardize mRNA expression in each sample. The primers used in this study are indicated in Supplementary Table S2 .
Rneasy lipid kit
Manufactured by Qiagen
Sourced in Germany, United Kingdom, United States
The RNeasy Lipid Tissue Kit is a product designed for the purification of total RNA from lipid-rich tissues, such as adipose tissue. The kit utilizes a silica-membrane technology to efficiently capture and purify RNA from the sample. The extracted RNA can be used for various downstream applications, such as gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Taqman reverse transcription reagent, by Thermo Fisher Scientific (6 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (6 mentions)
Rnase free dnase treatment, by Qiagen (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Rneasy kit, by Qiagen (3 mentions)
Lightcycler, by Roche (3 mentions)
High pure rna isolation kit, by Roche (2 mentions)
Agilent bioanalyzer, by Agilent Technologies (2 mentions)
Truseq rna sample preparation kit, by Illumina (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Iqtm sybr green supermix, by Bio-Rad (2 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (2 mentions)
Quantstudio 6 flex, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase, by Qiagen (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Premade primer sets, by Thermo Fisher Scientific (2 mentions)
Trizol rna isolation method, by Thermo Fisher Scientific (2 mentions)
43 protocols using rneasy lipid kit
1
Gene Expression Analysis Protocol
2
RNA-seq Analysis of BPA Effect
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from LCM samples using a Qiagen RNeasy Lipid kit (Qiagen). The RNA quality and quantity were assessed using Agilent Bioanalyzer (Agilent) and NanoDrop ND-1000 spectrophotometer (Thermo Scientific), respectively. RNA libraries were prepared according to manufacturer’s protocol of TruSeq RNA sample preparation kit (Illumina, San Diego, CA, USA) and were sequenced with Genome Analyzer II sequencing system in the Genomics, Epigenomics and Sequencing Core at the University of Cincinnati. Analysis of gene expression was performed with our standard pipeline (Govindarajah et al. 2016 (link)). Differentially expressed genes of the HBF + BPA group were selected based on P < 0.05 and a fold-change greater than 2, when compared with the HBF-alone group. Functional enrichment analysis of differentially expressed genes was performed using the knowledge-based Ingenuity Pathways Analysis (IPA) (Qiagen, www.qiagen.com/ingenuity ). RNA-seq data were deposited in the NCBI Gene Expression Omnibus database with accession number GSE73604.
3
qPCR Analysis of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from striate using the Qiagen RNeasy Lipid kit (Qiagen, Germany). Total RNA (1 μg) was retrotranscribed using the iScript cDNA Synthesis Kit and the cDNA analyzed by real-time PCR using the iQTM SYBR Green Supermix and a CFX96 Real-time PCR Detection System (Bio-Rad; Hercules, CA, USA). The HPRT gene was used to standardize mRNA expression in each sample. Gene expression was quantified using the 2-ΔΔCt method and the percentage of relative expression against controls (untreated cells or mice) was represented. The primers used in this study were: IL-6; forward: 5’GAACAACGATGATGCACTTGC3’; reverse: 5’TCCAGGTAGCTATGGTACTCC3’; TNFα; forward: 5’AGAGGCACTCCC CCAAAAGA-3; reverse: CGATCACCCCGAAGTTCCCATT.
4
Transcriptomic Analysis of Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA will be isolated from frozen adipose samples using Qiagen RNeasy Lipid Kit (Qiagen, Valencia, CA) and reversely transcribed into cDNA using iScript Reverse Transcription Supermix. Conventional quantitative real-time PCR will be performed using SYBR Green with respective primers for FAS and CPT-1 (Human ProbeLibrary Gene).49 (link) The relative gene expression will be assessed using the ΔΔCT method50 (link) and glyceraldehyde 3-phosphate dehydrogenase will be used as internal control for normalisation.49 (link) In addition, total RNA will be extracted from deidentified serum and adipose tissue for later stranded mRNA sequencing.
5
Quantitative mRNA Expression Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from brains and spinal cords using the Qiagen RNeasy lipid kit. RNA concentration was estimated using Nanodrop (Thermo scientific). 3′UTR probes were cloned from WT brain or spinal cord genomic DNA into a TOPO-TA (Invitrogen) vector by PCR. Digoxigenin-labeled antisense RNA 3′UTR probes were generated through in vitro transcription (Roche). RNA and an RNA ladder (Invitrogen) were run on formaldehyde gels (Ambion) for 2–3 h, then transferred upright for 4 h to N+ nylon membrane. RNA was crosslinked with a stratalinker, then the membrane was pre-hybridized with Ambion hybridization solution at 68°C. Probe was denatured and added to hybridization solution, and hybridization was carried out overnight. After membrane washings, CDP-Star development solution was used to detect bound probe. Membranes were exposed to X-ray film and developed.
6
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the liver, thoracic aorta, and soleus muscle tissue samples using the RNeasy Mini kit (Qiagen, Hilden, Germany), RNeasy plus Universal Mini kit (Qiagen), and RNeasy Lipid kit (Qiagen), respectively. For qPCR, cDNA was synthesized using the PrimeScript RT Reagent kit (Takara Bio, Shiga, Japan). qPCR assays were performed on the 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) using commercially available FAM-labeled TaqMan probes (TaqMan Gene Expression Assays; Applied Biosystems). The expression of each gene was normalized to that of the housekeeping gene encoding ribosomal phosphoprotein P0 (36B4). The genes assessed in this study are listed in Supplemental Table S1.
7
Quantifying Gene Expression in Rat Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Homogenization of the muscle samples and total RNA isolation were performed using TRIzol and QIAzol lysis reagents (Qiagen Inc., Hilden, Germany) and the RNeasy ® Lipid Kit (Qiagen) according to manufacturer's instructions. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) for cDNA synthesis was done in the Thermocycler TOptical Real-Time PCR (Analytik Jena AG, Jena, Germany) using 200 ng RNA and innuSCRIPT Reverse Transcriptase, innuNucleotide Mix and Random primer (Analytik Jena AG).
The following genes were quantified: collagen type 1 and type 2 (COL1A1 and COL2A1); insulin-like growth factor (IGF) 1 and IGF2; vascular endothelial growth factor (VEGF); and myostatin (MSTN), a negative regulator of muscle growth. The quantification of the expression of different rat genes were performed as described previously by using the master mix contained in the innuMix qPCR Master Mix Probe (Analytik Jena AG), ×10 specific probes and primers (IGF1: Rn 00710306_m1; IGF2: Rn 00580426_m1; VEGF: Rn 01511602_m1; MSTN: Rn 00569683_m1; COL1A1: Rn 01463848_m1; COL2A1: Rn 00563954_m1; Eukaryotic 18S rRNA Endogenous Control: 4310893E; PE (Applied Biosystems, Weiterstadt, Germany) and RNase free water. 7, 27 Fig. 1. Surgical approach: A -skin incision above the latissimus dorsi; B -insertion of the oxidized cellulose; C -wound closure using skin staples
The following genes were quantified: collagen type 1 and type 2 (COL1A1 and COL2A1); insulin-like growth factor (IGF) 1 and IGF2; vascular endothelial growth factor (VEGF); and myostatin (MSTN), a negative regulator of muscle growth. The quantification of the expression of different rat genes were performed as described previously by using the master mix contained in the innuMix qPCR Master Mix Probe (Analytik Jena AG), ×10 specific probes and primers (IGF1: Rn 00710306_m1; IGF2: Rn 00580426_m1; VEGF: Rn 01511602_m1; MSTN: Rn 00569683_m1; COL1A1: Rn 01463848_m1; COL2A1: Rn 00563954_m1; Eukaryotic 18S rRNA Endogenous Control: 4310893E; PE (Applied Biosystems, Weiterstadt, Germany) and RNase free water. 7, 27 Fig. 1. Surgical approach: A -skin incision above the latissimus dorsi; B -insertion of the oxidized cellulose; C -wound closure using skin staples
8
Quantitative PCR Analysis of Intestinal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Intestinal mucosa was collected from 6–17 week old male and female Ctrl and VC-Slfn3KO mice. Total RNA was isolated from intestinal duodenum, jejunum, and ileum using the RNeasy Lipid Kit and the QiaCube instrument per manufacturers’ protocols (Qiagen, Valencia, CA). Preparation of cDNA from RNA samples was performed using the SMARTScribe Reverse Transcription kit (Takara Clontech, Mountain View, CA). qPCR analysis of the cDNA samples were analyzed using the BioRad CFX96 Touch Real-Time PCR Detection System and the PrimeTime Gene Expression Master Mix from Integrated DNA Technology (IDT, Coralville, IA). RNA expression levels were ascertained from the threshold cycle (Ct) values using the 2-ΔΔCt method using RPLP0 as the reference control gene. Primer/probe sets and qPCR cycle conditions were previously published [16 ].
9
Preserving Brain RNA for Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Half brain specimens were submerged in RNA stabilization reagent, RNAlater (Sigma). RNA was extracted using the RNeasy Lipid kit (Qiagen, Manchester, UK) according to manufacturer’s instructions including the optional on-column DNase step. RNA was stored at −80 °C. RNA quantity was determined by spectrophotometry (NanoDrop, Thermo Fisher Scientific, Waltham, MA, USA) and analysed for quality on the Agilent RNA 6000 Nano Assay.
10
RNA Extraction and RNA-seq for Liposarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For tumors and subcutaneous fat, tissue was dissociated using a blade homogenizer and whole RNA was extracted using the QIAGEN RNeasy lipid kit according to the manufacturer’s protocol. For cell lines, whole RNA was extracted using the QIAGEN RNeasy kit according to the manufacturer’s protocol. For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Invitrogen 61011) and then ligated to RNA adaptors for sequencing. RNA-seq was performed with a minimum of two biological replicates per liposarcoma cancer line and in singlicate for tumor and normal fat samples. Libraries were sequenced as 75-base paired-end reads on an Illumina NextSeq500 instrument.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!