Total RNA was extracted from lung tissues using the RNA extraction kit (Qiagen, Hilden, Germany). qRT-PCR was performed utilizing the qRT-PCR kit (Thermo Fisher, United States) in the ABI StepOnePlus PCR system according to the manufacturer’s protocol. The ACTB mRNA expression level was employed as an internal control. The primers were designed as follows: SMAD4, forward, 5′-GTCATCCTGCTCACCAGATGTC-3′ and reverse, 5′-TGCTCAGACAGGCATCGTTAC-3′; HIF-1, forward, 5′-AGCAAGATCTCGGCGAAGC-3′ and reverse, 5′-ACCACCGGCATCCAGAAGT-3′; MAPK, forward, 5′-ACAGGCAGCGGAGACACCTA-3′ and reverse, 5′-GGGGAGGATGATCGAGACAC-3′; HRAS, forward, 5′-ATCCAGCTGATCCAGAACCAC-3′ and reverse, 5′-TCCCGCATGGCACTATACTC-3′; SOD1, forward, 5′-CAGAAGGCAAGCGGTGAAC-3′ and reverse, 5′-GAGGTCCTGCACTGGTACAGC-3′; AKT2, forward, 5′-TGCTGCCGCCAGTTCATA-3′ and reverse, 5′-GCAGGAGGCTCCTCGGATAC-3′; RAC1, forward, 5′-CAGATGCAGGCCATCAAGTG-3′ and reverse, 5′-GTCAAAGACGGTGGGGATGT-3′; P53, forward, 5′-CTCCCTCTGAGCCAGGAGAC-3′ and reverse, 5′-GACACTCGGAGGGCTTCACT-3′; ACTB, forward, 5′-TTCATGGATGCCACAGGATT-3′ and reverse, 5′-TGACGGCCAGGTCATCACTA-3′. The qRT-PCR results were analyzed and expressed as the relative mRNA expression of the CT (threshold cycle) value, which was then converted to fold changes.
Qrt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The QRT-PCR kit is a laboratory instrument designed for real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. It is used to detect and quantify specific RNA targets in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (15 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (4 mentions)
Rabbit anti clu antibodies, by Cell Signaling Technology (3 mentions)
Goat anti mouse or anti rabbit igg, by Cell Signaling Technology (3 mentions)
Mouse anti gapdh, by Proteintech (3 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Sybr green realtime pcr master mix, by Toyobo (3 mentions)
Trizol kit, by Thermo Fisher Scientific (2 mentions)
Trizol rna extraction kit, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Ncode mirna first strand cdna synthesis, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Lsm 710, by Zeiss (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Ripa lysis buffer, by Thermo Fisher Scientific (2 mentions)
Miscript reverse transcription kit, by Qiagen (2 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Steponeplus pcr system, by Thermo Fisher Scientific (1 mentions)
42 protocols using qrt pcr kit
1
Quantitative Expression Analysis of Lung Genes
2
Analysis of NORAD and miR-410-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA, in the above-mentioned serum specimen, was extracted with TRIzol reagent (ThermoFisher Scientific, MA, USA). The concentration and purity of RNA were measured by a spectrophotometer and the samples with absorbance (A260/280 nm) of 1.8–2.0 were taken. The first line of cDNA for NORAD was synthesized by a reverse kit (Promega, Madison WI, USA). For miR-410-3p, RNA was reverse transcribed into cDNA according to the miRNA reverse transcription kit instructions (Life Technologies, Carlsbad, California, US). Using GAPDH or U6 as the internal references for NORAD or miR-410-3p, the PCR reaction was carried out on the quantitative PCR instrument according to the instructions of the qRT-PCR kit (ThermoFisher Scientific, MA, USA). The primers applied in the qRT-PCR were as follows: NORAD (forward primer, 5ʹ-TGATAGGATACATCTTGGACATGGA-3ʹ; reverse primer, 5ʹ-AACCTAATGAACAAGTCCTGACATACA-3ʹ). GAPDH (forward primer, 5ʹ-GGAGCGAGATCCCTCCAAAAT-3ʹ; reverse primer, 5ʹ-GGCTGTTGTCATACTTCTCATGG-3ʹ), miR-410-3p, forward primer, 5ʹ-GTCAGCGCAATATAACACAG-3ʹ ‘; reverse primer, 5ʹ-GAGAACAGCTCTGTGTTATAT-3ʹ; and U6, forward primer, 5ʹ-CTCGCTTCGGCAGCACA-3”; reverse primer, 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ). The relative expression of NORAD and miR-410-3p in the serum and cells was calculated by the 2-delta Ct method.
3
Quantitative Analysis of TRPV1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were extracted with TRIzol one-step protocol (Invitrogen, USA) for total RNA content. By using UV detection and formaldehyde deformation electrophoresis, high-quality RNA was confirmed. qPCR was performed with qRT-PCR kit (Thermo Fisher). PCR primers (Table 1 ) were provided by Sangon (Shanghai, China). After the reaction, both amplification curves and dissolution curves were confirmed. TRPV1 gene expression was measured by the 2−ΔΔCt method and normalized to GAPDH.Table 1
RT-qPCR primers.
| Genes | Primers (5’–3’) |
|---|---|
| TRPV1 | Forward: GAAGCAGTTTGTCAATGCCAGCTA |
| Reverse: AGGGTCACCAGCGTCATGTTC | |
| GAPDH | Forward: GTCGGTGTGAACGGATTTG |
| Reverse: TCCCATTCTCAGCCTTGAC |
4
Quantification of CLU Protein and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The proteins in the bile were extracted by acetone precipitation. The protein solution was then separated by SDS/PAGE, transferred onto a PVDF membrane, and incubated overnight at 4°C with rabbit anti-CLU antibodies (1:1000, Cell Signaling) or mouse anti-GAPDH (1:2000, Proteintech). The membrane was later incubated with a secondary antibody of goat anti-mouse or anti-rabbit IgG (1:2000, Cell Signaling) and then visualized with chemiluminescence detection. RT-PCR was performed according to the instructions provided by the manufacturer using the qRT-PCR Kit (Thermo, USA). The forward and reverse PCR primers for CLU were 5′-GAGCAGCTGAACGAGCAGTTT-3′ and 5′-CTTCGCCTTGCGTGAGGT-3′ respectively; whereas for GAPDH, the forward primer was 5′-CCATCACCAT CTTCCAGG-3′, and reverse was 5′-ATGAGTCCTTCCACGATAC-3′. The relative expression levels of CLU mRNA were compared with GAPDH using the 2−ΔΔCt value. Each experiment was repeated three times.
5
Quantification of CLU Protein and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The proteins in the bile were extracted by acetone precipitation. The protein solution was then separated by SDS/PAGE, transferred onto a PVDF membrane, and incubated overnight at 4°C with rabbit anti-CLU antibodies (1:1000, Cell Signaling) or mouse anti-GAPDH (1:2000, Proteintech). The membrane was later incubated with a secondary antibody of goat anti-mouse or anti-rabbit IgG (1:2000, Cell Signaling) and then visualized with chemiluminescence detection. RT-PCR was performed according to the instructions provided by the manufacturer using the qRT-PCR Kit (Thermo, USA). The forward and reverse PCR primers for CLU were 5′-GAGCAGCTGAACGAGCAGTTT-3′ and 5′-CTTCGCCTTGCGTGAGGT-3′ respectively; whereas for GAPDH, the forward primer was 5′-CCATCACCAT CTTCCAGG-3′, and reverse was 5′-ATGAGTCCTTCCACGATAC-3′. The relative expression levels of CLU mRNA were compared with GAPDH using the 2−ΔΔCt value. Each experiment was repeated three times.
6
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the TRIZOL. RNA was reverse transcribed to cDNA using the qRT-PCR kit (Thermo Scientific, USA) according to the manufacturer’s protocol. The PCR cycling conditions were as follows: 40 cycles with pre-denaturation at 95°C for 15 min, denaturation at 95°C for 10 s, and annealing and extension at 60°C for 32 s.
The primers used in this study were synthesized by Wuhan Genecreate Biological Engineering Co., Ltd, and were as follows: MED19-F: CTGACAGGCAGCACGAATCT, MED19-R: CTCCTTCACCTTCTTCCCACA; AKT-F: TACTCTTTCCAGACCCACGAC, AKT-R: AGGTTCTCCAGCTTGAGGTC; mTOR-F: CGCTGTCATCCCTTTATCGAC, mTOR-R: CAGAGTCAAGTGGTCATAGTCCG; 4EBP1-F: CTCACCTGTACCAAAACACC, 4EBP1-R: CCCGCTTATCTTCTGGGCTA; p70S6K1-F: GTGCTGTGGATTGGTGGAGT, p70S6K1-R: GAGGTAGGGAGGCAAATTGAG; GAPDH-F: AGAAGGCTGGGGCTCATTTG, GAPDH-R: AGGGGCCATCCACAGTCTTC. All samples were normalized to internal controls and fold changes were calculated based on relative quantification (2-ΔΔCt).
The primers used in this study were synthesized by Wuhan Genecreate Biological Engineering Co., Ltd, and were as follows: MED19-F: CTGACAGGCAGCACGAATCT, MED19-R: CTCCTTCACCTTCTTCCCACA; AKT-F: TACTCTTTCCAGACCCACGAC, AKT-R: AGGTTCTCCAGCTTGAGGTC; mTOR-F: CGCTGTCATCCCTTTATCGAC, mTOR-R: CAGAGTCAAGTGGTCATAGTCCG; 4EBP1-F: CTCACCTGTACCAAAACACC, 4EBP1-R: CCCGCTTATCTTCTGGGCTA; p70S6K1-F: GTGCTGTGGATTGGTGGAGT, p70S6K1-R: GAGGTAGGGAGGCAAATTGAG; GAPDH-F: AGAAGGCTGGGGCTCATTTG, GAPDH-R: AGGGGCCATCCACAGTCTTC. All samples were normalized to internal controls and fold changes were calculated based on relative quantification (2-ΔΔCt).
7
Investigating mTOR Regulation in Bleomycin-Induced Fibrosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Res was purchased from Sigma-Aldrich Co. (St Louis, MO, USA). Bleomycin (BLM) was obtained from Enzo Life Sciences, Inc. (Farmingdale, NY, USA). qRT-PCR kit was purchased from Thermo Fisher Scientific Co. (Waltham, MA, USA). Small interfering RNA (siRNA) mTOR and the siRNA control were designed by Applied Biological Materials Inc. (Richmond, BC, Canada). Plasmid SIRT1 was purchased from the Public Protein/Plasmid Library (PPL, #BC012499). High-glucose Dulbecco’s modified eagle medium was purchased from Gibco BRL (Thermo Fisher).
8
Quantification of lncRNA NEAT1 and miR-23b-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (15596026; Thermo Fisher Scientific, USA) was used to extract RNA from tissues, and the quality of RNA was determined. RNA was used as the template and reverse transcribed into cDNA, which was completed by the reverse transcription kit (11141ES10; Shanghai Yeasen Biotechnology Co., Ltd., China). Real-time PCR was completed by the qRT-PCR kit (A15299; Thermo Fisher Scientific, USA) and the qRT-PCR system (7,500; Applied Biosystems, USA). The above operation steps were carried out according to the manufacturer’s instructions. GAPDH and U6 were chosen as the internal reference, and the results were calculated and analyzed according to the 2−ΔΔCt method. The primers were as follows: lncRNA NEAT1 primers (forward, 5′-TGGCTAGCTCAGGGCTTCAG-3′; reverse, 5′-TCTCCTTGCCAAGCTTCCTTC-3′); miR-23b-3p primers (forward, 5′-ACACTCCAGCTCCCATCACATTGCCAGGGAT-3; reverse, 5′-CTCAACTGGTGTCGTGGAGCGAGGTGGTAAT-3′); CYP1A2 primers (forward, 5′-TAGCTCAGCTAGCTCGA-3; reverse, 5′-CTAGCTACGCGCTCGCTCG-3′); GAPDH primers (forward, 5′-TGAACGGGAAGCTCACTGG-3′; reverse, 5′-TCCACCACCCTGTTGCTGTA-3′); and U6 primers (forward, 5′-CTCGCTTCGGCAGCACA-3′; reverse, 5′-AACGCTTCACGAATTTGCGT-3′).
9
Mitochondrial Dysfunction and Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DHT (purity ≥ 98%) was purchased from Chengdu Pufei De Biotech Co., Ltd. (Chengdu, China). MTS, N-Acetyl-L-cysteine (NAC), Ca2+ probe (Fluo-3/AM), and ROS probe (DCFH2-DA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). z-vad-fmk and vx765 were purchased from Selleck Chemicals (Houston, TX, USA). COX-2, TOM20, and GAPDH were purchased from Cell Signaling Technology (CST, Danvers, MA, USA). Porimin was purchased from Bioss (Beijing, China). TXNIP was purchased from Proteintech (Chicago, IL, USA). UCP2 was purchased from Affinit (Cincinnati, OH, USA). β-tubulin was purchased from Abmart (Shanghai, China). LDH assay kit and 10% sodium azide were purchased from Beyotime Biotechnology (Shanghai, China). Mitochondrial membrane potential assay kit (JC-1) was acquired from Thermo Fisher Scientific (Waltham, MA, USA). BCA protein assay kit, PVDF membranes, and qRT-PCR kit were bought from Thermo Fisher (Waltham, MA, USA). Annexin V-EGFP apoptosis detection kit was bought from Shanghai Epizyme Biomedical Technology Co., Ltd. (Shanghai, China).
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA content from cells was extracted using the one-step method of TRIzol kit (Invitrogen, Carlsbad, CA, USA). High-quality RNA was confirmed by UV analysis and formaldehyde deformation electrophoresis. According to the qRT-PCR kit (ThermoFisher), fluorescent qPCR was performed. PCR primers (Table 1 ) were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Amplification curve and dissolution curve were confirmed after reaction. The relative expression of miR and mRNAs was calculated by 2−ΔΔCt method, with GAPDH as the internal reference.
Primer sequences of RT-qPCR.
| Gene | Primer sequence |
|---|---|
| IP3R1 | F: 5′-ATGTCTGACAAAATGTCTAG-3′ |
| R: 5′-GCTTAGGCTGGCTGCTGTGG-3′ | |
| ERP44 | F: 5′-ATGAATCCTACCGTCTTCCTG-3′ |
| R: 5′-TTACAGCTCATCTCGATCCC-3′ | |
| GAPDH | F: 5′-GGGAGCCAAAAGGGTCAT-3′ |
| R: 5′-GAGTCCTTCCACGATACCAA-3′ |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!