First strand cdna synthesis kit

Human bronchial epithelial cells (16HBE cells) and human lung cancer cell lines (SPC-A-1 cells, NCI-H1975 cells) were cultured in DMEM (HyClone, United States). All mediums were supplemented with 10% fetal bovine serum (Gibco, United States), 100 U/mL of penicillin and 100 U/mL of streptomycin (Gibco, United States). The conditions of cell cultures were 37°C and 5% CO₂.
Total RNA were extracted from cultured cells by TRIzol (Invitrogen, Shanghai, China). Reverse transcription reactions were then performed by using a first-strand cDNA synthesis kit (novoprotein, Shanghai, China). Real-time PCR system was configured according to an ABI SYBR Green Master Mix (Applied Biosystems, United States), and the mRNA expressions of genes were detected by using a real-time fluorescent quantitative PCR instrument (QuantStudio 3, Thermo Fisher Scientific, United States). 2^−ΔΔCT method was used to caculated the relative expression levels of the genes. GAPDH was used as an internal reference. Primers used in RT-qPCR were listed in Supplementary Table S2.

Total RNA from lung tissues and RAW 264.7 cells were extracted using AxyPrep Multisource Total RNA kit (AXYGEN, USA). RNA was transcribed to cDNA using first strand cDNA synthesis kit (Novoprotein, Shanghai, China). The gene transcripts were detected using Novostart SYBER qPCR SuperMix Plus (Novoprotein, Shanghai, China) with a 7300 plus real-time PCR system (Applied Biosystems, USA) according to the manufacturer’s protocols. GAPDH was used as the internal reference. The sequences of primers were used as follows: mouse GAPDH forward: 5′- AGGTCGGTGTGAACGGATTTG-3′, reverse: 5′-CGCCACGAGCAGGAATGAGAAG-3′; mouse TNF-α forward: 5′-GCATGATCCGAGATGTGGAACTGG-3′, reverse: 5′-CGCCACGAGCAGGAATGAGAAG-3′; mouse IL-6 forward: 5′-AATTTCCTCTGGTCTTCTGGAGT-3′, reverse: 5′- GTGACTCCAGCTTATCTCTTGGT-3′; mouse IL-1β forward: 5′-GCAGAGCACAAGCCTGTCTTCC-3′, reverse: 5′-ACCTGTCTTGGCCGAGGACTAAG-3′; mouse IL-10 forward: 5′-TTCTTTCAAACAAAGGACCAGC-3′, reverse: 5′- GCAACCCAAGTAACCCTTAAAG-3′; mouse iNOS forward: 5′- ACTCAGCCAAGCCCTCACCTAC-3′, reverse: 5′-TCCAATCTCTGCCTATCCGTCTCG-3′; mouse CD86 forward: 5′- ACGGAGTCAATGAAGATTTCCT-3′, reverse: 5′- GATTCGGCTTCTTGTGACATAC; mouse Arg1 forward: 5′- CAGAAGAATGGAAGAGTCAG-3′, reverse: 5′-CAGAAGAATGGAAGAGTCAG-3′; mouse CD206 forward: 5′- CCTATGAAAATTGGGCTTACGG-3′, reverse: 5′-CTGACAAATCCAGTTGTTGAGG-3′. The relative mRNA level was calculated by 2^−ΔΔCt method.

The UNlQ-10 Column Trizol Total RNA Isolation Kit (B511361, Sangon Biotech, Shanghai, China) was used to extract total RNA. The RNA quality and concentrations were then assessed, and the first-strand cDNA synthesis kit (Novoprotein, Shanghai, China; E041) was employed to synthesize cDNA. The ABI ViiA 7 Real-time quantitative PCR system (Thermo) was employed to perform Real-time Quantitative PCR with ChamQ SYBR Color qPCR Master Mix (Q411-02, Vazyme, China). The sequences of primer were exhibted in Table S1.

Total RNA extraction from the grafted plant roots (control and treatment plants) was performed using a quick RNA isolation kit (HuayueYang Biotechnology, Beijing, China). RNA samples were stored at −80 °C until subsequent analyses. First strand cDNA was synthesized using a First Strand cDNA Synthesis Kit (Novoprotein, Suzhou, China). Previous reported primers were used for qRT-PCR. qRT-PCR experiments were performed in a final volume of 20 µL with the NovoStart^®SYBR qPCR SuperMix Plus kit (Novoprotein, Suzhou, China) using a LightCycler 480 II (Roche, Basel, Switzerland) on a 96-well plate. Each sample consisted of three technical replicates. The reaction mixture (20 μL) contained 10 μL of super mix, 0.8 μL of cDNA, 0.4 μL of each forward and reverse primers, and 8.4 μL of RNase-free water.