Cdna reverse transcription kit

Total RNA was extracted according to the manufacturer’s instructions by the RNA extraction kit (Solarbio, Beijing, China). Total RNA was reverse transcribed into cDNA using a cDNA Reverse Transcription Kit (Vazyme, Nanjing, China). RT-qPCR reaction conditions: predenaturation at 95 °C for 5 min; 40 cycles at 95 °C for 10 s and 60 °C for 30 s; melt curve at 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. The β-actin was used as an internal reference. The relative mRNA expression of LYRM4-AS1 was calculated using the 2^−ΔΔCt method (Livak & Schmittgen, 2001 (link)). The sequences of primers are listed in Table 1.

Total RNA was extracted from MEC-1 cells using TRIzol reagent (Takara, Ōtsu City, Japan) and tested for purity and concentration using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). DNA was removed from the RNA using a gDNA wiper mix (Vazyme, Nanjing, China), after which total RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit (Vazyme). A fluorescence quantitative PCR kit was purchased from Vazyme. The final results were determined using the CFX96 Touch System (Bio-Rad Laboratories, Hercules, CA, USA), a real-time fluorescence quantitative PCR instrument. The expression of the target genes was normalized using β-actin expression, and the final difference between the experimental and control groups of the target gene was calculated; 2^−a indicates the fold change in gene expression. The specific sequences of the target gene primers are shown in Supplement Table S2.

Total RNA was extracted from cells using TRIzol (Invitrogen, Carlsbad, CA, USA) according to provided instructions. RNA concentration and purity were measured in triplicates utilizing the NanoDrop 2000 spectrophotometer (Thermo Scientific Inc., Waltham, MA, 93 USA). Then, total RNA was reverse transcribed to cDNA using the cDNA Reverse Transcription Kit (Vazyme, Nanjing, China). qRT-PCR analyses were performed using SYBR® Premix Ex Taq™ II (Takara, Dalian, China) and Taqman UniversalMaster Mix II (Life Technologies Corporation, Carlsbad, CA, United States) on Applied Biosystems 7500/7500 Fast Real-Time PCR System (Thermo Fisher Scientific). The 2-ΔΔCt method was used to calculate the relative mRNA expression normalized by GAPDH and HTRA3. The sequences of primers used for PCR were as follows: HTRA3, 5′- AAGAAGTCGGACATTGCCACCATC -3′ (forward) and 5′- CCGTTGTCACTGTGTTCTGTAGGG -3′ (reverse); and GAPDH, 5′-GGAGCGAGATCCCTCCAAAAT-3′ (forward) and 5′- GGCTGTTGTCATACTTCTCATGG-3′ (reverse).

Total RNA was extracted with an RNA Purification Kit (cat #: RC101-01, Vazyme, Nanjing, China) and reverse transcription was performed with a cDNA Reverse Transcription Kit (cat #: R223-01, Vazyme, Nanjing, China). qRT-PCR was performed using SYBR Green qPCR Master Mix ((cat #: Q121-02, Vazyme, Nanjing, China). Relative gene expression was calculated using the 2^−ΔΔCT method, and GAPDH was used as a reference for normalization. The qPCR primers were listed in Additional file 2: Table S1.

Human ovarian cancer tissues and adjacent noncancerous tissues were collected, and total RNA was extracted using TRIzol Reagent (Invitrogen) according to the kit instructions. 1 μg of total RNA was reverse‐transcribed to cDNA using the cDNA Reverse Transcription kit (Vazyme, Nanjing, China) at 37 °C for 60 min. Real-time PCR was performed using TB Green™ Premix Ex Taq™ II (RR420A; Takara, China) in a Roche LightCycler®96 qRT-PCR system according to the manufacturer’s protocol. Primers for IRF6 (interferon regulatory factor 6) were, forward: 5′- CCCCAGGCACCTATACAGC-3′ and reverse: 5′- TCCTTCCCACGGTACTGAAAC-3′; GAPDH was used as an internal reference for the calculation of IRF6 RNA expression, expression difference was calculated using 2^−ΔΔCT method.

TRIzol was used to isolate total RNA from cardiomyocytes and cardiac tissues. cDNA was obtained by reverse transcription of RNA using a cDNA Reverse Transcription kit (Vazyme Biotech Co., Ltd.), incubating for 1h at 42°C, then 5-min at 75°C. qPCR was conducted using the SYBR Green PCR Master kit (Vazyme Biotech Co., Ltd.). The thermocycling conditions were as follows: initial denaturation at 95°C for 3-min, and 40 cycles of 95°C for the 30s, 56°C for 30s, and 72°C for 30s. Fold changes in gene expression were calculated using the 2^−ΔΔCq method.¹⁷ (link) mRNA expression levels were normalized to those of glyceraldehyde 3-phosphate dehydrogenase, the internal control. All experiments were performed in triplicate.