Primer pair

Manufactured by Merck Group

Sourced in Germany, Ireland, United States

Primer pairs are DNA sequences used in polymerase chain reaction (PCR) to selectively amplify a target DNA sequence. They consist of a forward primer and a reverse primer that bind to complementary sequences on the DNA template, enabling the enzyme DNA polymerase to replicate the target region.

Automatically generated - may contain errors

Lab products found in correlation

Rnase free water, by Thermo Fisher Scientific (2 mentions) Superscript 3 reverse transcriptase enzyme, by Thermo Fisher Scientific (2 mentions) Lightcycler 1, by Roche (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Kicqstart primers, by Merck Group (1 mentions) Random hexamers, by Merck Group (1 mentions) Sybr green detection reagent, by Thermo Fisher Scientific (1 mentions) Stepone real time pcr system machines, by Thermo Fisher Scientific (1 mentions) Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (1 mentions) Invitrap spin universal rna mini kit, by Stratec (1 mentions) Taq dna polymerase with standard taq buffer, by New England Biolabs (1 mentions) Rnaeasy mini kit, by Qiagen (1 mentions) Omniscript rt kit, by Qiagen (1 mentions) Rnase free dnase, by Qiagen (1 mentions) Ddpcr evagreen supermix kit, by Bio-Rad (1 mentions) Qx200 droplet reader, by Bio-Rad (1 mentions) Qx200 ddpcr system, by Bio-Rad (1 mentions) Tri reagent, by Merck Group (1 mentions) Icycler iq5 optical system, by Bio-Rad (1 mentions) Ssoadvanced sybr green supermix, by Bio-Rad (1 mentions)

10 protocols using primer pair

DNA Extraction and nim Gene Screening in Bacteroides fragilis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For DNA extraction, B. fragilis isolates were grown on 5% sheep blood agar for 48 h. Three to four colonies were inoculated into 100 μL distilled water in a microcentrifuge tube to match 3 McFarland standard. The tubes were heated for 15 min at 95°C, after cooling were centrifuged to remove the debris. The lysates were stored at −20°C, till further use.[13 (link)]
The B. fragilis group was screened for nim gene, as described by Trinh and Reysset[14 (link)] The primer pair (Sigma Aldrich) used was NIM-3, (5'-ATGTTCAGAGAAATGCGGCGTAAGCG-3'); and NIM-5, (5-GCTTCCTTGCCTGTCATGTGCTC-3'). Amplification process included, an initial denaturation step at 94°C for 10 min followed by 32 cycles of amplification consisting of denaturation at 94°C for 30 s, annealing at 62°C for 1 min, extension at 72°C for 1 min, and a final extension step at 72°C for 10 min. The end products were analyzed by agar gel electrophoresis. Fragments of approximately 458 bp in any of the isolates were considered as presumptive positive for nim gene.[14 (link)]

Vishwanath S., Shenoy P.A, & Chawla K. (2019). Antimicrobial Resistance Profile and Nim Gene Detection among Bacteroides fragilis Group Isolates in a University Hospital in South India. Journal of Global Infectious Diseases, 11(2), 59-62.

+ Open protocol

+ Expand

qPCR Analysis of Gene Expression Regulation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA purification, cDNA synthesis and qPCR reactions are previously described in [27 (link)]. Housekeeping genes for standardizations were TFRC and GAPDH. The primer pairs for the housekeeping genes and for MMP2 were purchased as KiCqStart primers from SIGMA (PrimerPair ID: H_TFRC_1, H_GAPDH_2 and H_MMP2_1). Other primers were designed by use of Primer3 [28 (link)]. Primer3 designed primer pairs for qPCR are shown in Table 3.Table 3

qPCR primer pairs

Gene	Forward Primer	Reverse primer
CAV1	5´-GAGCTGAGCGAGAAGCAAGT-3′	5´-CAAATGCCGTCAAAACTGTG-3´
CyclinD1	5´-CTGGATGCTGGAGGTCTGCGAG-3´	5´-GCCGTCAGGGGGATGGTCTC-3´
P27	5´-CAGCTTGCCCGAGTTCTACT-3´	5´-TGTCCTCAGAGTTAGCCGGA-3´
NRF2	5´-GCTTTCAACCAAAACCACCCT-3´	5´-TGATGCCACACTGGGACTTG-3´

Hegge B., Sjøttem E, & Mikkola I. (2018). Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress. BMC Cancer, 18, 496.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Purinergic Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complementary DNA (cDNA) was produced by reverse transcription using SuperScript III reverse transcriptase enzyme (Invitrogen, CA, USA) primed with 50 pmol of random hexamers (Sigma, Dublin, Ireland) using 500 ng of total RNA. qPCR was performed using the QuantiTech SYBR Green kit (Qiagen Limited, Hilden, Germany) and the LightCycler 1.5 (Roche Diagnostics, GmbH, Mannheim, Germany). Each reaction tube contained 2 μl cDNA sample, 10 μl SYBR Green Quantitect Reagent (Qiagen Limited, Hilden, Germany), 1.25 μM primer pair (Sigma, Dublin, Ireland) and RNAse free water (Invitrogen, CA, USA) to a final volume of 20 μl. Using LightCycler 1.5 software, data were analyzed and normalized to the expression of β-actin. Primers used (Sigma, Dublin, Ireland): P2ry1 forward: GTAGGTAGTACGCCAGGGTC, reverse: AAGTAGTTCGGCTGTTCCCA; c-Fos forward: GGAATTAACCTGGTGCTGGA, reverse: CATTCAGACCACCTCGACAA; P2rx2 forward: ATGGGATTCGAATTGACGTT, reverse: GATGGTGGGAATGAGACTGAA; P2rx4 forward: TATGTGGTCCCAGCTCAGGA, reverse: TCACAGACGCGTTGAATGGA and β-actin forward: GGGTGTGATGGTGGGAATGG, reverse: GGTTGGCCTTAGGGTTCAGG.

Conte G., Nguyen N.T., Alves M., de Diego-Garcia L., Kenny A., Nicke A., Henshall D.C., Jimenez-Mateos E.M, & Engel T. (2020). P2X7 Receptor-Dependent microRNA Expression Profile in the Brain Following Status Epilepticus in Mice. Frontiers in Molecular Neuroscience, 13, 127.

+ Open protocol

+ Expand

Hippocampal RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using whole hippocampi. 34 RNA concentration was measured via a nanodrop Spectrophotometer (Thermo Scientific, Rockford, IL, U.S.A) and absorbance determined at a ratio of 260/280. Samples with an absorbance ratio between 1.8-2.2 were considered acceptable. 500 µg of total mRNA was used to produce cDNA by reverse transcription using SuperScript III reverse transcriptase enzyme (Invitrogen, CA, U.S.A). qPCR was performed using LightCycler 1.5 (Roche Diagnostics, GmbH, Mannheim, Germany). Each reaction tube contained 2 μl cDNA, 10 μl SyBR green Quantitect Regent (Quiagen Ltd, Hilden, Germany), 1.25 μM primer pair (Sigma, Dublin, Ireland) and RNAse free water (Invitrogen CA, U.S.A) to a final volume of 20 μl. Data were analysed and normalized to the expression of β-actin. Primers used (Sigma, Dublin, Ireland) are listed in Table S4.

Conte G., Parras A., Jiménez-Mateos E.M., Ollà I., Diego-García L.d., Beamer E., Alalqam R., Ocampo A., Méndez R., Henshall D.C., Lucas J.J., & Engel T. (2020). High concordance between hippocampal transcriptome of the intraamygdala kainic acid model and human temporal lobe epilepsy.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the analysis of mRNA levels, cells were grown in 6-well culture dishes for 24 h in complete medium at 37°C in 5% CO₂. Cells were lysed, and total RNA was extracted using the InviTrap Spin Universal RNA Mini kit (Stratec Molecular). cDNA was obtained using the SuperScript III First-Strand Synthesis SuperMix (Invitrogen), all according to the manufacturer’s instructions. The Q-RT-PCR was performed in internal triplicates with the specific and efficient (efficiency between 90 and 110%) primer pairs (Sigma-Aldrich) listed in Table S2. The Q-RT-PCR reaction was performed using the SYBR green detection reagent (Applied Biosystems) in StepOne Real-Time PCR System machines (Applied Biosystems) using the StepOne software v2.3, all according to the manufacturer’s instructions with standard Q-RT-PCR cycling conditions. For each biological condition, the fold change (2^−ΔΔCT) of target mRNA was normalized to that of GAPDH.

Scharaw S., Iskar M., Ori A., Boncompain G., Laketa V., Poser I., Lundberg E., Perez F., Beck M., Bork P, & Pepperkok R. (2016). The endosomal transcriptional regulator RNF11 integrates degradation and transport of EGFR. The Journal of Cell Biology, 215(4), 543-558.

+ Open protocol

+ Expand

Molecular Analysis of Pluripotency Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from cell pellets using RNAeasy Mini Kit (Qiagen). Contaminating genomic DNA was eliminated by treating the samples with RNase-free DNase (Qiagen). cDNA was synthesized from 1 µg RNA using Oligo(dT) primers and the Omniscript RT Kit (Qiagen), according to manufacturer instructions. Primer pairs (Sigma) were designed and used for detection of the different pluripotency factors, and to discriminate between the endogenous (OCT4A, SOX2, NANOG, and c-MYC) and the exogenous (LIN28-NANOG fusion) transcripts (Supplementary Table 1). As positive and negative controls rhesus embryonic stem cells (Rh_ESC) and MEFs, respectively, were used. Endogenous beta-actin (ACTNB) expression was used as a house-keeping gene. Taq DNA Polymerase with Standard Taq Buffer (New England BioLabs) was used for all RT-PCRs performed. Original gel electrophoresis pictures of RT-PCR analysis can be found in Supplementary Fig. 13.

Rodriguez-Polo I., Mißbach S., Petkov S., Mattern F., Maierhofer A., Grządzielewska I., Tereshchenko Y., Urrutia-Cabrera D., Haaf T., Dressel R., Bartels I, & Behr R. (2021). A piggyBac-based platform for genome editing and clonal rhesus macaque iPSC line derivation. Scientific Reports, 11, 15439.

+ Open protocol

+ Expand

Droplet Digital PCR Quantification of Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ddPCR experiments were performed with a QX200 ddPCR system (Bio-Rad) and ddPCR Eva Green Super Mix kit (Bio-Rad), according to the manufacturer’s protocol. Briefly, cDNA (1.5 μl per sample) and the corresponding primer pairs (0.165 μM; Sigma) were added to the Eva Green Super Mix at a final volume of 20 μl. Then, droplets were generated with the aid of a QX200 droplet generator by adding 70 μl of the ddPCR oil. The emulsion product (40 μl) was subsequently transferred to a 96-well plate for PCR reaction. Finally, the samples were read using a Bio-Rad QX200 droplet reader. Data were analyzed with a QuantaSoft software and expressed as number of copies per micrograms of RNA [27 (link)]. Forward (F) and reverse (R) primers were designed for each gene by using the Beacon Designer software (Premier Biosoft). Primer sequences used are shown in Table 1.

Costa-Besada M.A., Valenzuela R., Garrido-Gil P., Villar-Cheda B., Parga J.A., Lanciego J.L, & Labandeira-Garcia J.L. (2017). Paracrine and Intracrine Angiotensin 1-7/Mas Receptor Axis in the Substantia Nigra of Rodents, Monkeys, and Humans. Molecular Neurobiology, 55(7), 5847-5867.

+ Open protocol

+ Expand

Inflammatory Gene Expression in Cartilage and Paw

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted from cartilage and paw tissue (50–100 mg) using Tri-reagent (Sigma). RNA quantification and purity assessed by UV-Vis spectroscopy at 260–280 nm. Then carried out cDNA synthesis and amplification in eppendorf thermal cycler according to manufacturer's protocol. The RT-PCR products were electrophoresed through a 1.5% agarose gel and band were visualized and quantified using gel doc analyzer (Major Science). The signals were expressed relative to the intensity of GAPDH in each sample. The primer pairs (Sigma) for TLR-4, TNF-α, COX- 2, iNOS and GAPDH were as follow (Table 1).Table 1

Forward and reverse primers of inflammatory genes.

Table 1

Gene	Forward primer	Reverse primer
COX-2TLR4TNFαiNOSIL-1βIL-10GAPDH	5′CCAAACCAGCAGGCTCATACT3′5′AGTGTATCGGTGGTCAGTGTGCTT3′5′TGCTCAGAAACACACGAGACGC3′5′CAGCACAGAGGGCTCAAAGG 3′5′AACCTGCTGGTGTGTGACGTTC3′5′AGAGCCCCAGATCCGATTTT3′5′TCAAGAAGGTGGTGAAGCAG3′	5′AGCGGATGCCAGTGATAGAGT3′5′ATGAAGATGATGCCAGAGCGGCTAG3′5′TTCAGCAGCCTTGTGAGCCAGA3′5′TCGTCGGCCAGCTCTTTCT 3′5′CAGCACGAGGCTTTTTTGTTGT3′5′CATCAAGGCGCATGTGAACT3′5′AGGTGGAAGAATGGGAGTTG3′

I. S. A., Krishnan S., Peter J., Sabu V, & Helen A. (2019). Scientific validation of anti-arthritic effect of Kashayams – A polyherbal formulation in collagen induced arthritic rats. Journal of Ayurveda and Integrative Medicine, 12(1), 20-27.

+ Open protocol

+ Expand

Growth Factor Receptor Gene Expression in MPCs and MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

MPCs and MSCs from primary cultures were washed twice in D-PBS, and pellets cryo-preserved in liquid nitrogen to be processed. Total RNA extraction was performed soon after thawing, using RNeasyMicro Kit (Qiage, Hilden, Germany) according to manufacturer. RNA samples (100 ng) were retro-transcribed using QuantiTect® Reverse Transcription Kit (Qiagen) and 2 μl samples of 10-fold cDNA dilutions were amplified by quantitative Real Time PCR (qRT-PCR), using iCycler-iQ5 Optical System (Bio-Rad, Hercules, USA-CA) and SsoAdvancedSYBR Green SuperMix (Bio-Rad). Samples were run in duplicate. Primer pairs (Sigma-Aldrich, St. Luis, USA-MO) were designed to detect growth factor receptor genes: BMPR1A, BMPR2, EGFR, FGFR1, FGFR2, FGFR3, IGF1R, IGF2R, KDR, PDGFRA, PDGFRB, TGFBR1, TGFBR2, and TGFBR3 (Supplementary Table S1). Relative quantitative analysis was performed following 2^−ΔΔCt Livak method (Livak and Schmittgen, 2001 (link)). Normalization was performed by using RPL13A and ACTB housekeeping genes. Values were reported as log-ratios of mean MPC/MSC normalized fold expression.

Montali M., Barachini S., Panvini F.M., Carnicelli V., Fulceri F., Petrini I, & Pacini S. (2016). Growth Factor Content in Human Sera Affects the Isolation of Mesangiogenic Progenitor Cells (MPCs) from Human Bone Marrow. Frontiers in Cell and Developmental Biology, 4, 114.

+ Open protocol

+ Expand

Cysteine Substitution in QacA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each target residue in QacA was individually substituted with cysteine using site-directed mutagenesis based on the QuikChange^™ method (Stratagene).^{20 (link)} Details of the primer pairs (Sigma–Aldrich) containing a cysteine codon along with a silent mutation for restriction site screening are provided in Table S1 (available as Supplementary data at JAC Online). DNA sequencing was conducted (Australian Genomic Research Facility, Adelaide) to verify the presence of the incorporated cysteine as well as the absence of spurious mutations within the entire qacA sequence.

Dashtbani-Roozbehani A., Chitsaz M, & Brown M.H. (2023). The role of TMS 12 in the staphylococcal multidrug efflux protein QacA. Journal of Antimicrobial Chemotherapy, 78(6), 1522-1531.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!