Applied biosystems quantstudio 3 real time pcr system

TRAP was employed to identify the telomeric repeat (TTAGG)n of insects using the following primers: TS primer: 5′-AAGCCATCGAGCAGAGTT-3′; Bm-CX: 5′-GTGTAACCTAACCTAACC-3′ (Sasaki and Fujiwara 2000 (link)). Specifically, we extracted cell protein and determined the protein concentration as described above. Incubated 10 mg of protein, TS primer, and dNTP at 30 °C for 60 min followed by heating at 95 °C for 5 min. The resulting products were subsequently mixed with dNTP, TS primer, Bm-CX primer, and Taq DNA polymerase (TransGen Biotech, Beijing, China) and amplified by PCR using a thermal cycler (Bio-Rad Laboratories) with 35 cycles at 94 °C for 30 s and 60 °C for 30 s. PCR products were electrophoresed on 12% non-denaturing polyacrylamide gels at 200 V for 45 min, followed by visualization of the signals using GelRed nucleic acid dyes (Sangon Biotech Shanghai). The corresponding signals were detected by analyzing digital images with ChemiDocTM XRS+ (Bio-Rad Laboratories).
The TRAP products generated in the initial step were amplified using TS and Bm-CX primers, along with PowerUp™ SYBR Green Master Mix (Applied Biosystems) and subjected to qPCR analysis on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Applied Biosystems). The relative quantification of genes was determined utilizing the 2^−ΔΔCt method with actin as an internal standard.

For DNA extraction from citrus plants, leaf midribs were cut into small pieces using a razor blade (0.1 g fresh weight), placed into 2 mL screw cap tubes, and frozen in liquid nitrogen for 10 min. Frozen leaf tissue was processed at 30 Hz for 1 min (2 × 30 s) using a Tissuelyzer II (Qiagen, Germantown, MD, USA). The tubes of homogenized leaf tissue were removed from the sample blocks and were centrifuged for 1 min at 6000× g. DNA was extracted using potassium acetate buffer. Extracted DNA was adjusted to 100 ng/μL and then used for RT-qPCR amplification using TaqMan Universal PCR master mix (Life Technologies, Carlsbad, CA, USA) and degenerate genus-specific (rpoB) primer-probe sets [44 (link)]. Assays were performed in a 96-well plate using an Applied Biosystems QuantStudio 3 Real-Time PCR system and related supplies (Applied Biosystems, Foster City, CA, USA). Data were analyzed with the QuantStudio™ Design and Analysis Software (version 1.4.3) and expressed as the DNA amplification cycle threshold (Ct).

qtuantitative polymerase chain reaction was performed using Takara AAVpro^™ Titration kit standard (cat# 6233) and Fisher Scientific Company's Master Mix, qPCR (Applied Biosystems) and Power Up SYBR Green Master Mix (cat# A25776). 50X Primer Mix was prepared as follows: AAV Forward ITR Primer 5 µl, AAV Reverse ITR primer 5 µl, and water 15 µl. The qPCR reaction mix consisted of SYBR green Premix 12.5 µl, 50X Primer Mix 0.5 µl, water 7 µl, and template DNA (~10 ng) 5 µl. Primers for the pAAV2 plasmid ITR and MCO were as follow: The AAV2 ITR qPCR is based on the forward primer (forward ITR primer, 5′‐GGAACCCCTAGTGATGGAGTT‐3′) and the reverse primer (reverse ITR primer, 5′‐CGGCCTCAGTGAGCGA‐3′). Real‐time PCR was performed on the Applied Biosystems QuantStudio 3 real‐time PCR System (Applied Biosystems) using assays specific for ITR. qPCR conditions were as shown in the Figure S2. Samples were analysed in duplicate for vector copy number/ng DNA by the absolute quantification method using standard curves. Preparation of the standard curve was performed following the manufacturer's reference guide.

Cellular RNA was extracted from cultures using the Tri Reagent kit (#RT 111, Molecular Research Center, Cincinnati, OH, USA), as described in the manufacturer’s protocol for cells grown in monolayer. ABI Universal PCR Master Mix and TaqMan primer and probe pair reagents were acquired from Applied Biosystems/ThermoFisher Scientific. Gene expression was evaluated using quantitative RT-PCR using Applied Biosystems QuantStudio 3 real-time PCR system (Applied Biosystems/ThermoFisher Scientific). Target mRNA expression levels were normalized to the expression of the housekeeping gene, cyclophilin, relative to controls. We used cyclophilin primer and probe sequences: 5′-GGTGGAGAGCACCAAGACAGA-3′(forward), 5′-GCCGGAGTCGACAATGATG-3′(reverse), and 5′-TCCTTCAGTGGCTTGTCCCGGCT-3′(probe). All other gene expression primers and probes were purchased from Applied Biosystems. Corresponding cycle threshold (Ct) values were measured, and relative mRNA level was determined using the 2^(−ΔΔCt) method.

The expression of miR-124 was quantified using TaqMan^® miRNA assays, as described [24 (link),30 (link),31 (link)]. Briefly, total RNA was extracted using Quick-RNA™ MiniPrep Plus (Catalog No. R1058, Zymo Research, Orange, CA, USA), per the manufacturer’s protocol. Thus, the total RNA isolated was reverse transcribed to synthesize cDNA for individual miRNA using specific miRNA primers from the TaqMan^® miRNA assays and the TaqMan^® miRNA Reverse Transcription kit (Catalog No. 4366597, Thermo Fisher Scientific, Waltham, MA, USA). The reverse transcription product was then diluted 1:10 for the following PCR reaction. Each PCR reaction was carried out in triplicate, and six independent experiments were run. TaqMan^® miRNA assays were performed using an Applied Biosystems^® QuantStudio^™ 3 Real-Time PCR System (Applied Biosystems, Grand Island, NY, USA). The expression level of miR-124 was calculated by normalizing with U6 snRNA.

DNA was extracted using potassium acetate buffer as described in our previous study [24 (link)]. Extracted DNA was adjusted to 100 ng/μL and then used for RT-qPCR amplification using a TaqMan Universal PCR master mix (Life Technologies, Carlsbad, CA, USA) and degenerate genus-specific (rpoB) primer-probe sets [24 (link)]. Assays were performed using an Applied Biosystems QuantStudio 3 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). (Ct). The qPCR cycle threshold (Ct) values ≤ 35 were assigned as positive for ‘Ca. L. asiaticus’ infection, whereas qPCR Ct values > 35 were assigned as negative [24 (link)].