Trizol reagent

In vitro transcribed RNA for primer extension and reverse transcription in circle (cRT) was obtained with Riboprobe in vitro Transcription Systems (Promega) using linear pGemT-3′UTR_At3g18145. The [³²P]CTP-labeled RNA substrates were transcribed from linear pBSIIk+ plasmids containing rcr1 sequences (GeneCust). Primer extension (20 (link)) analysis was performed using in vitro transcribed RNA treated or untreated with His-RTL1 and specific 5′ end labeled primers p1, p2 and p7. For Reverse Transcription in circle (cRT) reactions, His-RTL1 treated RNA was incubated with T4 RNA ligase (Promega) for 1 h at 37°C. The reaction was then used to perform RT with UTRrt primers, followed by 42 cycles PCR with p1/p8 primers. PCR products were purified on 2% agarose gel, cloned and sequenced. Total RNA from Wt and RTL1-Flag plants was prepared using TriZol reagent (GE Healthcare, Littler Chalfont, Buckinghamshire, UK). All RNA samples were then treated with Turbo DNase (Ambion) to eliminate contaminant DNA (21 (link)).

TRIZOL Reagent or RNAspin Mini kit (GE Healthcare, UK) was used for RNA extraction and isolation, followed by DNAseI treatment to eliminate genomic DNA. RNA was quantified using the NanoDrop2000 spectrophotometer. Reverse transcription (RT) of 1 µg of total RNA was performed using the SuperScript First Strand Synthesis System for RT-PCR kit (Life Technologies, Carlsbad, California, USA). Real-time quantitative PCR was carried out on the resulting cDNA using SYBR Green PCR Master Mix (Life Technologies) on the ABI 7300 real-time PCR machine (Life Technologies) to determine the transcript expression of IL-12β and IFN-β; cytochrome C served as a reference gene. Analysis was performed using the delta-delta C_T (2^−ΔΔCT) method. The primer sequences were as follows: cytochrome c forward: CTGCCACAGCATGGATTATG; cytochrome c reverse: CATCATCATTAGGGCCATCC; IL-12β forward: CATCTGCTGCTCCACAAGAA; IL-12β reverse: TTGGTGCTTCACACTTCAGG; IFN-β forward: ACTTGAAGAGCTATTACTGGAGGG; IFN-β reverse: TTCCTGAAGATCTCTGCTCGG; Tmem173 forward: TGTCTCCCCATTCAGAAGCC; Tmem173 reverse: CATCTTCTGCTTCCTAGACCGG.