7500 fast real time pcr thermocycler

Manufactured by Thermo Fisher Scientific

The 7500 FAST Real-Time PCR thermocycler is a laboratory instrument used for conducting real-time polymerase chain reaction (PCR) experiments. It is designed to rapidly amplify and detect specific DNA sequences in a sample.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

7500 Fast (121 citations) 7500 Fast Real-Time PCR (92 citations) 7500 Real-Time PCR (79 citations) 7500 thermocycler (28 citations) 7500 Fast thermocycler (20 citations) 7500 real-time thermocycler (13 citations) PCR thermocycler (11 citations) 7500 Fast Real-Time thermocycler (9 citations) 7500 Real-Time PCR thermocycler (8 citations) 7500 Fast Real-Time (6 citations)

9 protocols using 7500 fast real time pcr thermocycler

Quantifying Fungal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mycelial RNA extraction and purification of biological triplicates were carried out as described previously (Ries et al. 2016 (link)). cDNA was synthesized from 1 μg RNA using the Superscript III Reverse Transcriptase kit (Invitrogen) according to manufacturer’s instructions. RT-qPCR reactions of the biological triplicates were carried out in technical duplicates as previously described (Ries et al. 2016 (link)). Briefly, 20 μl reactions containing 1 μl cDNA or 1 μl of known standard curve DNA, 10 μl SYBR Green PCR Master Mix (AB Applied Biosystems) and 15 pmol/μl forward and reverse primers were carried out in technical triplicates in the 7500 Fast Real-Time PCR thermocycler and gene expression by absolute quantification was analyzed using the 7500 Fast system v.1.4.0 (AB Applied Biosystems).
Primer pairs 22 and 23, 24 and 25 and 26 and 27 were used for pkpA, pkpB and pkpC amplification (S2 Table). The glucose transporter-encoding genes hxtB, was amplified with primer pairs 28 and 29 (S2 Table).

Ries L.N., José de Assis L., Rodrigues F.J., Caldana C., Rocha M.C., Malavazi I., Bayram Ö, & Goldman G.H. (2018). The Aspergillus nidulans Pyruvate Dehydrogenase Kinases Are Essential To Integrate Carbon Source Metabolism. G3: Genes|Genomes|Genetics, 8(7), 2445-2463.

+ Open protocol

+ Expand

Detecting NDV Strains via qRT-PCR and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantitative polymerase chain reactions (qRT-PCR) were performed for 98 samples (78 pooled tracheal and cloacal swabs, and 20 tissue samples) by targeting the matrix (M) gene conserved regions. A forward primer M+4100-5’-AGT GAT GTG CTC GGA CCT TC-3, ‘reverse primer M4220-5’CCT GAG GAG AGG CAT TTG CTA-3’ and a Probe of M+4100- 5’FAM- TTC TCT AGC AGT GGG ACA GCC-TAMRA-3’5 (link) were used for M-gene assay. The amplification process was performed by using an Applied Biosystems 7500 fast real-time PCR thermocycler. In addition, conventional PCR was performed using NDV strain positive samples that were identified by qRT-PCR using a second primer set targeting the F gene (270 bp size cleavage site motif region) with NOH-5’-TAC ACC TCA TCC CAG ACA GG-3 ‘forward primer and NOH-5’- AGT CGG AGG ATG TTG GCA GC −3’ reverse primer sequences for sequencing the PCR product to precisely detect the NDV strain for its genotype characterization. Gel electrophoresis was performed by preparing a 2% agarose gel supplied with a power and Gel doc system that was connected for imaging (Gel DocTM XR+, version 5.0 of Molecular Image Lab software) at Animal Health Institute.

Alemu E.E., Senbata B., Sombo M., Guyassa C., Alemayehu D.H., Kidane E., Mihret A., Mulu A, & Dinka H. (2024). Molecular Detection and Characterization of Newcastle Disease Virus from Chickens in Mid-Rift Valley and Central Part of Ethiopia. Veterinary Medicine : Research and Reports, 15, 149-157.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was prepared using Trizol (Invitrogen/Life Technologies). For qPCR expression analysis cDNA was reverse transcribed from total RNA using Verso kit (Thermo Scientific). qPCR was performed using SYBR Green PCR Master Mix kit (Applied Biosystems) in a 7500 FAST Real-Time PCR thermocycler with v2.0.5 software (Applied Biosystems). mRNA fold change was calculated using a 2^-ΔΔCt method in relation to the 18S reference gene. The qPCR graphs show the mean of three biological replicates ± s.e.m. The primers used for qPCR are listed in Table S1.

Foskolou I.P., Jorgensen C., Leszczynska K.B., Olcina M.M., Tarhonskaya H., Haisma B., D’Angiolella V., Myers W.K., Domene C., Flashman E, & Hammond E.M. (2017). Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication. Molecular Cell, 66(2), 206-220.e9.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For mRNA expression, total RNA, including short RNAs, were extracted from whole spinal cords (WT mice or ALS pre-symptomatic or symptomatic mice) using the miRNeasy® Mini Kit (QIAGEN). One μg of extracted RNA was reverse transcribed with the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). mRNA levels of TrkC isoforms and TNF-α were analyzed by real-time quantitative PCR using SYBR Green I (Quanta) in an 7500 FAST real-time PCR thermocycler (Applied Biosystems) and thermal cycling was performed as follows: 94° C for 30 sec, followed by 40 cycles at 94° C for 5 sec, 60° C for 30 sec. Specific primers were designed for the two TrkC isoforms and TNF-α. GAPDH or β-tubulin III were used as housekeeping genes (Table 1). Data are expressed as the mean relative quantification (RQ) ± SEM (n = 8 individual mice per group). WT samples were used as a calibrator (RQ = 1).

Brahimi F., Maira M., Barcelona P.F., Galan A., Aboulkassim T., Teske K., Rogers M.L., Bertram L., Wang J., Yousefi M., Rush R., Fabian M., Cashman N, & Saragovi H.U. (2016). The Paradoxical Signals of Two TrkC Receptor Isoforms Supports a Rationale for Novel Therapeutic Strategies in ALS. PLoS ONE, 11(10), e0162307.

+ Open protocol

+ Expand

qPCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction, reverse transcription and qPCR were performed using the Ambion Power SYBR Green Cells‐to‐CT kit following manufacturer's instructions in a 7500 FAST Real‐Time PCR thermocycler with v2.0.5 software (Applied Biosystems). The mRNA expression level of each gene relative to GAPDH was calculated using the ΔΔC_t method. All experiments were performed in triplicates.

Chatzifrangkeskou M., Pefani D., Eyres M., Vendrell I., Fischer R., Pankova D, & O'Neill E. (2019). RASSF1A is required for the maintenance of nuclear actin levels. The EMBO Journal, 38(16), e101168.

+ Open protocol

+ Expand

Quantitative Analysis of miRNA Expression in ALS

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MicroRNA cDNA synthesis was performed with the qScript microRNA cDNA synthesis kit (Quanta) using 1 μg of total spinal cord RNA. Then, a real time SYBR Green qRT-pCR amplification of miRNAs were performed using 200 nM of each Perfecta microRNA assay primers for miR-128-1 (destabilizes TrkC.T1), miR-151-3p (destabilizes TrkC-FL) [51 (link)], or RNU6 (as reference) and universal primers (Quanta). qRT-PCR was performed using an 7500 FAST real-time PCR thermocycler (Applied Biosystems) and thermal cycling was performed as follows: pre-incubation/activation; 95° C for 2 min, followed by 40 cycles at 94° C for 5s, 60° C for 30s. The WT mRNA sample was used as a calibrator (RQ = 1). Data are expressed as the mean + SEM from 6 individual mouse spinal cords of ALS or WT.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction, reverse transcription and qPCR reaction were implemented by using the Ambion^® Power SYBR^® Green Cells‐to‐CT™ kit following manufacturer's instructions (Thermo) in a 7500 FAST Real‐Time PCR thermocycler with v2.0.5 software (Applied Biosystems). Calculation of mRNA fold change was analysed by using a 2^(ΔΔCt) method in relation to the YAP, P4HA2 or GAPDH reference genes.

YAP1 sense: 5′‐TAGCCCTGCGTAGCCAGTTA‐3′, antisense: 5′‐TCATGCTTAGTCCACTGTCTGT‐3′;

GAPDH sense: 5′‐TGCACCACCAACTGCTTAGC‐3′, antisense: 5′‐GGCATGGACTGTGGTCATGAG‐3′;

P4HA2 sense: 5′‐GCCTGCGCTGGAGGACCTTG‐3′, antisense: 5′‐TGTGCCTGGGTCCAGCCTGT‐3′;

OCT4 sense: 5′‐TCAGGTTGGACTGGGCCTAGT‐3′, antisense: 5′‐GGAGGTTCCCTCTGAGTTGCTT‐3′;

SOX2 sense: 5′‐ GAGGGCTGGACTGCGAACT‐3′, antisense: 5′‐ TTTGCACCCCTCCCAATTC‐ 3′;

NANOG sense: 5‐GAAATCCCTTCCCTCGCCATC‐3′and antisense: 5′‐CTCAGTAGCAGACCCTTGTAAGC‐3′.

Pankova D., Jiang Y., Chatzifrangkeskou M., Vendrell I., Buzzelli J., Ryan A., Brown C, & O'Neill E. (2019). RASSF1A controls tissue stiffness and cancer stem‐like cells in lung adenocarcinoma. The EMBO Journal, 38(13), e100532.

+ Open protocol

+ Expand

Quantification of Piezo1 Expression in Cholangiocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction and DNase treatment of cholangiocytes were achieved with the NucleoSpin RNA kit according to the manufacturer’s instructions. RT reactions were performed as described above. qPCR reactions were run in duplicate using the Kapa Sybr Fast qPCR kit on an Applied Biosystems 7500 Fast Real-Time PCR thermocycler. Sequences of specific primers are listed in Table S3. The relative quantification (RQ) method was used to compare the relative expression of the Piezo1 gene between scramble-siRNA (siCtr)– and siPiezo1-transfected cholangiocytes.

Desplat A., Penalba V., Gros E., Parpaite T., Coste B, & Delmas P. (2021). Piezo1–Pannexin1 complex couples force detection to ATP secretion in cholangiocytes. The Journal of General Physiology, 153(12), e202112871.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction, reverse transcription and qPCR were performed using the Ambion^® PowerSYBR^® Green Cells‐to‐CT™ kit following manufacturer's instructions in a 7500 FAST Real‐Time PCR thermocycler with v2.0.5 software (Applied Biosystems). mRNA fold change was calculated using a 2(ΔΔCt) method in relation to GAPDH reference gene (all primers used are listed below).

Pefani D.E., Tognoli M.L., Pirincci Ercan D., Gorgoulis V, & O'Neill E. (2018). MST2 kinase suppresses rDNA transcription in response to DNA damage by phosphorylating nucleolar histone H2B. The EMBO Journal, 37(15), e98760.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!