M13 mp18 phage genome

BIO-RP-purified DNA oligonucleotides (such as biotin-5′ GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC3′, as a biotin-labelled G-quadruplex insulin aptamer [27 (link)], and DNT staples) were synthesized by Bioneer, Korea. In addition, to rule out non-specific insulin binding, a control 30 mer DNA oligonucleotide was synthesized by Bioneer with a random sequence (biotin-5' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN3′). M13mp18phage genome and T4 DNA ligase were purchased from New England Biolabs (Massachusetts, USA). Quantum Prep Freeze ‘N Squeeze DNA gel-extraction spin columns were obtained from Bio-Rad. Streptavidin (fluidMAG-Streptavidin) magnetic nanoparticles of 100 nm diameter size and a Magneto PURE-Micro separator were purchased from Chemicell (Germany). 3, 3′, 5, 5′ tetramethylbenzidine (TMB), hemin (Bioextra, from porcine), insulin and stop reagent for the TMB substrate were provided from Sigma, USA. Hemin stock solution (5 mM) was prepared in dimethyl sulfoxide (DMSO) (purchased from Bio Idea Company, Tehran, Iran), stored in the dark at – 20°C and diluted to the required concentration with buffer solution (20 mM Tris-HCl, 40 mM KCl, 200 mM NaCl, 0.06%(v/v) Triton X-100, pH 7.4). The desired concentration of insulin was dissolved in binding buffer (20 mM Tris-HCl, 140 mM NaCl, 5 mM KCl, 1 mM CaCl₂ and 1 mM MgCl₂, pH 7.4). The insulin ELISA kit was purchased from Demeditec, Germany.