Pljm1 egfp lentiviral vector

The CDS of BDH1, encoding the human BDH1 gene, was amplified through PCR using primers 5′-TATAGCTAGCATGCTGGCCACCCG-3′ and 5′-TATAACCGGTTCAGCGGATGTAGATCAT-3′, and then cloned into pLJM1-EGFP lentiviral vector (Addgene, 19319). The CDS of mouse Bdh1 gene was amplified through PCR using primers 5′-TATACTCGAGATGCTAGCTGCC-3′ and 5′- TATAGAATTCTCAGTGTATGTAGATCTTGT-3’, and then ligated into a retroviral vector, namely MSCV-PIG (Addgene, 105594).

Human cDNA of OGN was subcloned into the pLJM1-EGFP lentiviral vector (Plasmid #1931, Addgene diagnostic digest). Viral vector, the expression of which was highly cell specific (target gene), was transfected into HEK293T cells in accordance with the instructions from manufacturers (Addgene). Viral supernatants were collected after 48 h, centrifuged at 1500×g for 5 min, filtered with a 0.45 μm filter, aliquoted, and stored at −80 °C. Viral titer was determined by serial dilution and infection of SMMSCs. SMMSCs, which were isolated from SAM-P6 mouse, were infected with empty control vector pLJM1-EGFP for 8 h, respectively. Cells were screened out by puromycin for 8 days after 2 days of infection, the resistant clones of which were pooled and confirmed as OGN-positive SMMSCs by Western blotting and EmGFP for easy determination of lentiviral titer by flow cytometry (data not shown).

The CDS of ALOX5, encoding the human ALOX5 gene, was amplified through PCR using primers 5′-ATAACCGGTCCACCATGGATTACAAGGATGACGATGACAAGCCCTCCTACACGGTC-3′ and 5′-AGCGAATTCTCAGATGGGCACACTGTTCGGA-3′, and then cloned into pLJM1-EGFP lentiviral vector (Addgene, Cambridge, MA). The CDS of mouse Alox5 gene was amplified through PCR using primers 5′-AATCTCGAGCCACCATGGATTAC AAGGATGACGATGACAAGCCCTCCTACACG and 5′-ATTGAATTCTTAGATGGCTACGCTGTTGGGAAT-3, and then ligated into a retroviral vector, namely MSCV-PIG (i.e., MSCV-puro-IRES-GFP vector; bearing GFP gene), a kind gift from Drs. Gregory Hannon, Scott Hammond, and Lin He (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).