96 well white pcr plate

The qPCR was performed in a CFX96 Real Time PCR Detection System (Bio-Rad), using 96-well white PCR plate (Thermo) sealed with ABsolute qPCR seals (Thermo). The reaction mix consisted of 7.5 μL of the DyNamo ColorFlash SYBR Green master mix (Thermo), 300 nM of each primer and 3 μL of the 1:10 diluted cDNA in a final volume of 15 μL. The PCR reaction cycle was: initial denaturation for 7 min at 95°C, followed by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C. A melting curve was performed at the end of the qPCR run, increasing the temperature in a stepwise fashion by 0.5°C every 5 seconds, from 65°C to 95°C. Each RT-qPCR reaction was performed in technical triplicate. Two control samples were included for each primer pair tested; the no template control (NTC) and T. versatilis genomic DNA. For each sample, a ValidPrime Assay (VPA), consisting of a pair of primers that bind to a non-transcribed intergenic region identified from RNA-seq data, was also included to detect and quantify the presence of contaminating gDNA [47 (link)]. The primers for the VPA were; 5′ACCGAATGGCACCGAGTTGG 3′ and 5′AATGGAGGAAGCGTGCCGTG 3′. As gDNA contamination rarely exceeded 1%, the RT-qPCR data were directly analysed using the CFX Manager software (Bio-Rad).

A 2× detection mix containing SYPRO Orange Protein stain (Sigma-Aldrich) diluted into PAC Sample Buffer to a 7.5× concentration and 0.4 mM AcCoA or 0.4 mM puromycin was added as required. 10 µL of PAC at 0.1 mg/mL and 10 μL of the 2× detection mix were combined in a 96 well white PCR plate (Thermo Fisher Scientific). Fluorescence with excitation/emission filters at 490/570 nm was measured while ramping the temperature 1.0 °C every minute from 25 to 100 °C. Melting temperatures (T_m) were determined using Meltdown^{46 (link)}.