DNA extraction was performed as described by Gomez et al. (2017) (link). DNA was amplified with a set of oligonucleotide primers targeting the V4 region of the 16S rRNA gene with overhanging adapters for annealing to Illumina universal index sequencing adaptors (Klindworth et al., 2013 (link), Slifierz et al., 2015 (link)). The library pool was sequenced with an Illumina MiSeq (Illumina RTA v1.17.28; MCS v2.2) for 250 cycles from each end.
Universal index sequencing adaptors
Manufactured by Illumina
Universal index sequencing adaptors are designed for library preparation in next-generation sequencing workflows. They are compatible with a wide range of sequencing platforms and applications, allowing for the addition of sample-specific index sequences to DNA fragments. These adaptors enable parallel processing and multiplexing of samples during sequencing, facilitating efficient utilization of sequencing capacity.
Automatically generated - may contain errors
Lab products found in correlation
E z n a stool dna kit, by Omega Bio-Tek (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Agencourt ampure xp bead, by Beckman Coulter (2 mentions)
Genegenius bioimaging system, by Syngene (2 mentions)
Miseq system, by Illumina (1 mentions)
Universal adapter, by Illumina (1 mentions)
Ampurex, by Beckman Coulter (1 mentions)
8 protocols using universal index sequencing adaptors
1
Microbial Community Profiling via 16S rRNA
2
Amplifying 16S rRNA for Illumina Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The V3 and V6 hypervariable regions of the 16SrRNA gene were PCR amplified from microbial genomic DNA with the forward (TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A) and reverse (GGA CTA CHV GGG TWT CTA AT) primers. The primers were designed with overhanging adapters (Forward: AATGATA CGGC GACC ACCGA GATCT ACAC), (Reverse: GGA CTA CHV GGG TWT CTA AT) for annealing to Illumina universal index sequencing adaptors that were added in a later PCR (Dubinsky & Braun, 2015 (link); Haas et al., 2011 (link)). The PCR products were evaluated by 2% agarose gel electrophoresis and purified. After purification, spectrophotometry was used to quantify the PCR products. Samples were normalized to a final concentration of 2 nM.
3
Equine Gut Microbiome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal samples were collected at the time of each horse’s hospital visit. Once a bowel movement occurred, 2 to 3 g of feces was collected from the middle of a fecal pile. The samples were immediately packaged, labeled, and stored in a −80 °C freezer until processing. Once thawed, bacterial DNA was extracted from the samples using a commercially available kit (EZNA Stool DNA Kit). DNA extraction was performed as previously described [25 (link)]. Following extraction, DNA was amplified with a set of oligonucleotide primers targeting the V4 region of the 16S rRNA gene with overhanging adapters for annealing to Illumina universal index sequencing adaptors [26 (link)]. The library pool was sequenced with an Illumina MiSeq (Illumina RTA v1.17.28; MCS v2.2) for 250 cycles from each end.
4
16S rRNA Amplicon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The V3‑V4 region of the bacterial 16S rRNA gene was amplified with PCR using the 341F primer (5′ – CCTAYGGGRBGCASCAG – 3′) and the 806R primer (5′ – GGACTACNNGGGTATCTAAT – 3′) as specified by Novogene (https://en.novogene.com/services/research-services/metagenomics/16s-18s-its-amplicon-metagenomic-sequencing/ ). Purified amplicons were subjected to extension PCR using barcoded Illumina universal index sequencing adaptors prior to sequencing. Samples were sequenced (paired-end) using the Illumina MiSeq system (experiment 1) or Illumina Novoseq system (experiment 2) (performed by Novogene Co., Ltd., Beijing, China). Different sequencing techniques were used because in-house protocol changes at Novogene in between the execution of the two experiments. Paired-end reads were assigned to samples based on their unique barcode and truncated by cutting off the barcode and primer sequence.
5
Microbiota Profiling from Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For microbiota processing, fecal samples collected at 2 sampling points over the duration of the trial, at Day 6 (before challenge) and at Day 36 (28 days after challenge) (Fig 1), stored at -20°C, were used. DNA was extracted from fecal samples using a commercial kit (E.Z.N.A. Stool DNA Kit, Omega Bio-Tek Inc., Doraville, Georgia, USA) following the manufacturer's protocol. DNA concentration and purity were quanti ed using spectrophotometry (NanoDrop, Thermo Scienti c, USA). The V4 hypervariable region of the 16S rRNA gene was ampli ed using forward (5′-AYTGGGYDTAAAGNG-3′) and reverse (5′-TACNVGGGTATCTAATCC-3′) primers consisting of overhanging adapter regions to anneal with Illumina universal index sequencing adaptors that were required for a later polymerase chain reaction (PCR) [27] .
For the ampli cation of the 16S rRNA V4 region, a previously describe protocol was used [28] . To assess the quality of the PCR products, electrophoresis using 1.5% agarose gel was used and evaluated under a UV light using the GeneGenius bioimaging system (Syngene, USA). The puri cation of the PCR product was done using Agencourt AMPure XP beads (Beckman Coulter Inc, Mississauga, Ontario, Canada) following a previously described protocol [28, 29] . Approximately 50 μl of the product was transferred to a microcentrifuge tube and stored at -20°C before being processed.
For the ampli cation of the 16S rRNA V4 region, a previously describe protocol was used [28] . To assess the quality of the PCR products, electrophoresis using 1.5% agarose gel was used and evaluated under a UV light using the GeneGenius bioimaging system (Syngene, USA). The puri cation of the PCR product was done using Agencourt AMPure XP beads (Beckman Coulter Inc, Mississauga, Ontario, Canada) following a previously described protocol [28, 29] . Approximately 50 μl of the product was transferred to a microcentrifuge tube and stored at -20°C before being processed.
6
Microbiota Profiling from Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For microbiota processing, fecal samples collected at 2 sampling points over the duration of the trial, at Day 6 (before challenge) and at Day 36 (28 days after challenge) (Fig 1), stored at -20°C, were used. DNA was extracted from fecal samples using a commercial kit (E.Z.N.A. Stool DNA Kit, Omega Bio-Tek Inc., Doraville, Georgia, USA) following the manufacturer's protocol. DNA concentration and purity were quanti ed using spectrophotometry (NanoDrop, Thermo Scienti c, USA). The V4 hypervariable region of the 16S rRNA gene was ampli ed using forward (5′-AYTGGGYDTAAAGNG-3′) and reverse (5′-TACNVGGGTATCTAATCC-3′) primers consisting of overhanging adapter regions to anneal with Illumina universal index sequencing adaptors that were required for a later polymerase chain reaction (PCR) [27] .
For the ampli cation of the 16S rRNA V4 region, a previously describe protocol was used [28] . To assess the quality of the PCR products, electrophoresis using 1.5% agarose gel was used and evaluated under a UV light using the GeneGenius bioimaging system (Syngene, USA). The puri cation of the PCR product was done using Agencourt AMPure XP beads (Beckman Coulter Inc, Mississauga, Ontario, Canada) following a previously described protocol [28, 29] . Approximately 50 μl of the product was transferred to a microcentrifuge tube and stored at -20°C before being processed.
For the ampli cation of the 16S rRNA V4 region, a previously describe protocol was used [28] . To assess the quality of the PCR products, electrophoresis using 1.5% agarose gel was used and evaluated under a UV light using the GeneGenius bioimaging system (Syngene, USA). The puri cation of the PCR product was done using Agencourt AMPure XP beads (Beckman Coulter Inc, Mississauga, Ontario, Canada) following a previously described protocol [28, 29] . Approximately 50 μl of the product was transferred to a microcentrifuge tube and stored at -20°C before being processed.
7
Fecal Microbiome Profiling Using 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from 200 mg (wet weight) of fecal samples with a commercial Kit.3 The V4 region of the 16S rRNA gene was amplified with the forward (5′‐AYTGGGYDTAAAGNG‐3′) and reverse (5′‐TACNVGGGTATCTAATCC‐3′) primers14 The primers were designed with overhanging adapters (Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG,Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) for annealing to Illumina universal index sequencing adaptors that were added in a later PCR. The reaction mixture and amplification conditions have been described previously.15 The PCR products were purified with magnetic beads.4 Illumina universal adapters (Forward: AATGATACGG CGACCACCGAGATCTACAC‐index‐TCGTCGGCAGCGTC, Reverse: CAAGCAGAAGACGGCATACGAGAT‐index‐GTCTCGTGGGCTCGG) then were added to the purified 16S rRNA gene product by PCR.15 The PCR products were evaluated by electrophoresis in 1.5% agarose gel and purified as described above. After purification, spectrophotometry5 was used to quantify the PCR products. Samples were normalized to a final concentration of 2 nM. The library pool was submitted to the Genomics Facility of the University of Guelph and sequenced with an Illumina MiSeq6 for 250 cycles from each end.
8
16S rRNA Gut Microbiome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples were processed at the same time at the Ontario Veterinary College. DNA was extracted from faecal and caecal samples using a commercial kit (E.Z.N.A.) as per manufacturer’s instruction. DNA quantity and quality were assessed via spectrophotometry (NanoDrop). The V4 region of the 16S rRNA gene was amplified, then a second PCR reaction was performed to attach (Caporaso et al., 2010 (link)) Illumina universal index sequencing adaptors. After purification with AMPure X (Beckman Coulter Inc.) and assessment of DNA spectrophotometry, DNA quantity was normalized to a final concentration of 2 nM. Sequencing was performed using an Illumina MiSeq (Illumina MiSeq) (2 × 250 chemistry).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!