Absolute sybr green mix

H295R cells were cultured under normal growth and starvation conditions and total RNA was isolated using the TRIzol method according to the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). RNA was reverse-transcribed to cDNA using the Improm RNA transcriptase kit (Promega) as previously described12 (link)71 (link). qRT-PCR analysis was performed on the 7500-Fast real-time PCR System (Applied Biosystems, Foster City, CA, USA) using ABsolute SYBR Green Mix (ABgene; Thermo Fisher scientific, Waltham, MA, USA). Briefly, qRT-PCR was performed in 96 well plates using 50 ng/well cDNA and 1 μl (20 pmol/μl) specific primers (Microsynth, Balgach, Switzerland) in a total volume of 25 μl. The cyclophilin A gene was used as endogenous control. Specific primer sequences may be found in Supplementary Table S1. Fold change in gene expression for a particular gene was calculated by the 2^−ΔΔCt method72 (link)73 (link). Amplification curves and the mean cycle threshold (Ct) values were calculated using the 7500 Fast System SDS software (Applied Biosystems), and correction for the endogenous gene, ΔCt and ΔΔCt were calculated as previously described12 (link).

H295R cells were cultured under GM and SM conditions, and with resveratrol and metformin treatments. Total RNA was isolated using the TRIzol method according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). cDNA was produced using the Improm RNA transcriptase kit (Promega). qRT-PCR analysis was performed on the 7500-Fast real-time PCR System (Applied Biosystems, Foster City, CA, USA) using ABsolute SYBR Green Mix (ABgene; Thermo Fisher scientific, Waltham, MA, USA), specific primers (Microsynth, Balgach, Switzerland) and 50ng mRNA in a total volume of 25μl. specific primers were newly designed using the NCBI primer designing tool Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primer sequences are given in Supplemental Material (S1 Table). Cycling conditions comprised a first incubation at 50°C for 2 min and a second incubation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. GAPDH was used as endogenous control. Fold change in gene expression for a particular gene was calculated by the 2^−ΔΔCt method. Amplification curves and the mean cycle threshold (Ct) values were calculated using the 7500 Fast System SDS software (Applied Biosystems), and correction for the endogenous genes, ΔCt and ΔΔCt were calculated [19 (link)]

Total RNA was extracted with Trizol (Life Technologies). Reverse transcription was performed using random priming and Superscript Reverse Transcriptase (Life Technologies). Quantitative real-time PCR was performed using Absolute SYBR Green mix (Thermo Scientific) in an ABI PRISM 7300 thermocycler (Applied Biosystems). Variations in input RNA were corrected by subtracting the number of PCR cycles obtained for GAPDH.

Total RNA was isolated using the NucleoSpin RNA mini kit (740955, Macherey-Nagel, Düren, Germany), cDNA synthetized with iScript cDNA Synthesis Kit (1708891BUN, BioRad, Feldkirchen, Germany) and RT-qPCR performed in technical triplicates with ABsolute SYBR Green Mix (AB-1158B, Thermo Fisher Scientific, Darmstadt, Germany) according to the instructions of the manufacturers using Stratagene Mx3000P qPCR System (Agilent Technologies, Waldbronn, Germany). Results were evaluated by the Cy0 method 58 (link) with RPL27 used for normalization. The following primers were used:
RPL27: AAAGCTGTCATCGTGAAGAAC and GCTGTCACTTTGCGGGGGTAG;
IL6: AGGAACAAGCCAGAGCTGTGCAGATG and TTTGTGGTTGGGTCAGGGGTGGTTA; THBS1: TCTCTGACCTGAAATACGAATGTAG and AAGGAAGCCAAGGAGAAGTG; CCL20: GCTGCTTTGATGTCAGTGCT and GCAGTCAAAGTTGCTTGCTTC;
LPAR1: ATTTCACAGCCCCAGTTCACA and ACCAGCTTGCTGACTGTGTT;
LPAR2: GCCTGGTCAAGACTGTTGTCA and CCAGGACATTGCAGGACTCA;
LPAR3: CCAACGTCTTGTCTCCGCATA and CCGGGGTCCAGCATACCA

Tumor cells were treated with 100 nM LBH589 for 16 to 72 h before cells were harvested and mRNA was isolated using the NucleoSpin RNA isolation kit according to the manufacturer’s instructions (Macherey-Nagel). Absolute SYBR Green Mix (ThermoFisher Scientific, Schwerte, Germany) was used with the following primers: ULBP2_for 5′-GCCGCTACCAAGATCCTTCT-3′, ULBP2_rev 5′-GCAAAGAGAGTGAGGGTCGG-3′, MICA_for 5′-CTGCAGGAACTACGGCGATA-3′, MICA_rev 5′-CCCTCTGAGGCCTCGCT-3′, L27_for 5′-AAAGCTGTCATCGTGAAGAAC-3′ and L27_rev 5′-GCTGTCACTTTGCGGGGGTAG-3′. The qPCR reactions were run in technical triplicates in a Thermo Cycler Mx3005P (Stratagen) using the following protocol: Initial step of 95 °C for 15 min, then 40 cycles of 95 °C for 15 s, 60 °C for 20 s and 72 °C for 15 s, followed by a denaturation step at 95 °C for 60 s and a melting curve analysis. The relative expression level of genes of interest was calculated by the ΔΔCt-method, with each target normalized to L27. Biological replicates were used to calculate standard deviations.

Total RNA was extracted with Trizol (Life Technologies). Reverse transcription was performed using random priming and Superscript Reverse Transcriptase (Life Technologies), according to the manufacturer’s guidelines. Quantitative real-time PCR was performed using Absolute SYBR Green mix (Thermo Scientific) in an ABI PRISM 7500 thermocycler (Applied Biosystems).