Ready to go first strand beads

Total RNA was extracted from cells or liver tissues with an RNA isolation kit according to the instructions (Sigma-Aldrich). First-strand cDNA was synthesized from 1 µg of total RNA using Ready-to-go first strand beads (GE Healthcare). RT-qPCR was performed by using the GoTaq Real-Time qPCR mix (Promega). GAPDH was considered as a reference gene to normalize target gene expression. Fold changes were determined by using 2ΔΔCt and normalized to GAPDH. Finally, the fold changes were obtained by converting the logarithmic scale to an exponential scale (2^ΔΔCt). The primers are listed in Table 1.

Total RNA was extracted from cells by using RNA isolation kit (Sigma‐Aldrich). First strand cDNA was synthesized from 1 µg of total RNA using ready‐to‐go first strand beads (GE Healthcare); RT‐qPCR was performed by using Go Taq Real‐Time qPCR mix (Promega); GAPDH was considered as reference gene to normalize target gene expression. Fold changes were determined by using 2‐ΔΔCT and normalized to GAPDH. Finally, the fold changes were obtained by converting the logarithmic scale to an exponential scale (2‐ΔΔCT). The primers were used as follows: IMPDH1_F, GCACACTGTGGGCGAT; IMPDH1_R, GAGCCACCA CCAGTTCA; IMPDH2_F, TCTTCAACTGCGGAGAC; IMPDH2_R, CTGTAAGCGCCATT GCT; GAPDH_F, GTCTCCTCTGACTTCAACAGCG; GAPDH_R, ACCACCCTGTTGCTGTAGCC AA.

Murine corneal epithelium and conjunctival tissue were collected from wild-type C57BL/6 J mice according to previously published methods^{20 (link)}. In brief, total RNA was extracted with Qiagen RNeasy Plus Micro RNA isolation kit (Qiagen, Germantown, MD, USA) following the manufacturer’s protocol. One sample equaled the tissue pooled from both eyes of each animal. cDNA was synthesized using Ready-To-Go First-Strand beads (GE Healthcare Life Sciences, Marlborough, MA, USA) and random hexamers (Life Technologies, Grand Island, New York, USA) with 1 µg total RNA as template. DNA concentration was measured with a Qubit spectrophotometer (Life Technologies). Digital polymerase chain reaction (PCR) was performed as previously described with a QuantStudio 3D Digital PCR system (Life Technologies) with Slc5a8 Taqman assay primer set Mm00520629_m1 (Applied Biosystems, Inc. [ABI], Foster City, CA) and normalized by concentration of cDNA^{33 (link)}.