Pires2 acgfp

Manufactured by Takara Bio

Sourced in United States

PIRES2-AcGFP is a plasmid vector that contains the AcGFP (Aequorea coerulescens Green Fluorescent Protein) reporter gene. The AcGFP gene is under the control of a constitutive promoter, allowing for continuous expression of the green fluorescent protein in transfected cells.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000 reagent, by Thermo Fisher Scientific (5 mentions) Pgpu6 gfp neo, by GenePharma (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Pcmv6 entry, by OriGene (1 mentions) Stable competent e coli, by New England Biolabs (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions) Ecori, by Promega (1 mentions) Amaxa nucleofector, by Lonza (1 mentions) Pspcas9 bb 2a gfp px458 plasmid, by Addgene (1 mentions) Pspcas9 bb 2a puro px459 plasmid, by Addgene (1 mentions)

11 protocols using pires2 acgfp

Overexpression and Knockdown of SOX17 and β-Catenin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length SOX17 and β-catenin cDNA was amplified (primers seen in Table S2). SOX17 and β-catenin cDNA was subcloned into pIRES2-AcGFP (Clontech, Mountain View, CA) to generate pIRES2-AcGFP-SOX17 and pIRES2-AcGFP-CTNNB1 expressing plasmids.
The small interfering RNA expression vector that expresses a SOX17-specific short hairpin RNA (shRNA) with the vector bone of pGPU6/GFP/Neo was purchased from GenePharma Co., Ltd (C02007, genepharma, Shanghai, China). The primers were described in Table S2. Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was used for transfection according to the manufacturer’s instructions. After treatment with G418 (Calbiochem, La Jolla, CA, USA) for 3 weeks, the transfected cells were collected and expanded, and then the drug-resistant colonies were identified.

Li L., Yang W.T., Zheng P.S, & Liu X.F. (2018). SOX17 restrains proliferation and tumor formation by down-regulating activity of the Wnt/β-catenin signaling pathway via trans-suppressing β-catenin in cervical cancer. Cell Death & Disease, 9(7), 741.

+ Open protocol

+ Expand

Generating Slug Overexpression and Knockdown Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length Slug cDNA was amplified using the following primers: forward, 5′-GTTGAATTCGTTATG CCGCGCTCCTTCCTG-3′ and reverse, 5′-CGCGGATCC TCAGTGTGCTACACAGCAG-3′. The Slug DNA fragment was subsequently cloned into the EcoRI and BamHI sites of the internal ribosome entry site vector pIRES2-AcGFP (Clontech, Mountain View, CA) to generate the pIRES2-AcGFP-Slug recombinant plasmid. The small interfering RNA expression vector that expresses a Slug-specific short hairpin RNA (shRNA) was purchased from GenePharma (Shanghai, China). The Slug overexpression and shRNA vectors were transfected into SiHa, C33A, HeLa and CasKi cells using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The transfected cells were treated with G418 (Calbiochem, La Jolla, CA, USA) for 3 weeks to collect, expand, and identify the drug-resistant colonies. The recombinant Akt1 plasmid was adapted from a previous study [66 (link)].

Cui N., Yang W.T, & Zheng P.S. (2016). Slug inhibits the proliferation and tumor formation of human cervical cancer cells by up-regulating the p21/p27 proteins and down-regulating the activity of the Wnt/β-catenin signaling pathway via the trans-suppression Akt1/p-Akt1 expression. Oncotarget, 7(18), 26152-26167.

+ Open protocol

+ Expand

Overexpression and Silencing of Bmi1 in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length Bmi1 cDNA was amplified (16 (link)), and then the Bmi1 cDNA fragment was subsequently cloned into the EcoRI and BamHI sites of the internal ribosome entry site vector pIRES2-AcGFP (Clontech Laboratories, Inc.) to generate the pIRES2-AcGFP-Bmi1 recombinant plasmid. The Bmi1 short hairpin (sh)RNA named GenePharma SuperSilencing shRNA^™, for which the plasmid was pGPU6/GFP/Neo, was used to specifically silence the expression of Bmi1 (Shanghai GenePharma Co., Ltd.).
All transfection experiments were performed using Lipofectamine^® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. In brief, 10⁵ cells were seeded in 6-well plate and transfected with 2 µg pIRES2-AcGFP-Bmi1 and shBmi1 or empty vector. After culturing in medium containing 1 mg/ml geneticin (cat. no. G418; Genetical; Ameresco, Inc.) for 2–3 weeks, pooled stable clones were isolated. Clones that expressed the Bmi1 cDNA coding region, or Bmi1 silenced cells, were maintained in medium containing 0.8 mg/ml geneticin and used for further investigation.

Xu R., Chen L, & Yang W.T. (2019). Aberrantly elevated Bmi1 promotes cervical cancer tumorigenicity and tumor sphere formation via enhanced transcriptional regulation of Sox2 genes. Oncology Reports, 42(2), 688-696.

+ Open protocol

+ Expand

Generating Stable HNF4A Expressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CDS of HNF4A was cloned by PCR and subsequently inserted into pIRES2-AcGFP (Clontech, Mountain View, CA) to construct pIRES2-AcGFP-HNF4A plasmids. The pIRES2-AcGFP plasmids were used as control vectors. The primers used were shown as follows: HNF4A-CDS-F: CCGGAATTCATGCGACTCTCCAAAA, and HNF4A-CDS-R: CGCGGATCCCTAGATAACTTCCTGCTT.
The Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used as a transfection reagent according to the manufacturer's instructions. The G418 reagent (MCE, New Jersey, CA, USA) was used as selection pressure for stable transfection cell lines.

Ma H.M., Zhang Q., Yang X.M., Hu Y., Zhang J., Chen L., Zhao B., Yang W.T, & Xu R. (2022). HNF4A Regulates the Proliferation and Tumor Formation of Cervical Cancer Cells through the Wnt/β-Catenin Pathway. Oxidative Medicine and Cellular Longevity, 2022, 8168988.

+ Open protocol

+ Expand

Cloning and Silencing of HOXA5 in Cervical Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CDS of HOXA5 was cloned by PCR and were inserted into pIRES2-AcGFP (Clontech, Mountain View, CA) to construct pIRES2-AcGFP-HOXA5 expressing plasmids. HOXA5-specific shRNAs were cloned and inserted into pGPU6/GFP/Neo (GenePharma, Shanghai, China) to restrain the expression of HOXA5.
The pSpCas9(BB)-2A-GFP (PX458) plasmid (Plasmid #68370) containing SpCas9 and pSpCas9(BB)-2A-Puro (PX459) plasmid (Plasmid #48139) were purchased from Addgene (Cambridge, MA, USA). The single guide RNA targeting the first exon of HOXA5 were designed using the website (http://crispr.mit.edu/).
To obtain the stable transfection cell lines, the plasmids were transfected into cervical cancer cell lines using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. G418 (MCE, New Jersey, CA, USA) was added into the media of transfected cells for selection with stress.

Ma H.M., Cui N, & Zheng P.S. (2020). HOXA5 inhibits the proliferation and neoplasia of cervical cancer cells via downregulating the activity of the Wnt/β-catenin pathway and transactivating TP53. Cell Death & Disease, 11(6), 420.

+ Open protocol

+ Expand

Transfection of 293T Cells with Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T cells were grown to ~70–80% confluence in DMEM containing 10% FBS, Pen-Strep, and L-Glut before transfection using Lipofectamine LTX without Plus Reagent (Invitrogen). The following full-length cDNA expression plasmids were either generated using commercially available vectors or purchased from the indicated vendors: Myc-DDK tagged ASC in pCMV6-Entry (Origene); N-terminally HA-tagged Casp1 in pCMV-HA (Clonetech); N-terminally-StrepTag mouse Casp1 in pCMV-Script (Stratagene); Full-length IL-1β in pIRES2-AcGFP (Clonetech); N-terminally Flag-tagged A20 in pCMV-Tag2 (Stratagene). 3x HA-tagged wildtype Ub, K63-only Ub, K48R Ub, and K63R Ub pcDNA3.1 constructs were kind gifts from Dr. Vishva Dixit (Genentech). Cells were typically transfected in 6-well format in 2 mL media with 150 ng/well of each vector, except for Ub constructs (which were used at 3 µg/well) and A20 (which varied from 0–50 ng/well).

Duong B.H., Onizawa M., Oses-Prieto J.A., Advincula R., Burlingame A., Malynn B.A, & Ma A. (2015). A20 restricts ubiquitination of pro-interleukin-1β protein complexes and suppresses NLRP3 inflammasome activity. Immunity, 42(1), 55-67.

+ Open protocol

+ Expand

Synthesis and Cloning of Optimized VAR2CSA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length VAR2CSA sequences from seven alleles were synthesized with mammalian optimized codons by Genscript (FCR3, NF54, HB3, 7G8, M. Camp, and M920 alleles) and Genewiz (M200101 allele). The boundaries of all the full-length VAR2CSA constructs include NTS to DBL6 or DBL7 (for M200101) domain (Table 1). The codon-optimized sequences were cloned into pIRES2-AcGFP with primers (Sigma Aldrich) containing NheI and BamHI overhangs by a PCR reaction (Q5, NEB) to amplify VAR2CSA. The PCR product was cloned into the NheI and BamHI sites of pIRES2-AcGFP (Clonetech) using restriction digestion and ligation with T4 DNA ligase (NEB). Cloning into pHLSEC plasmid construction was similarly performed with modification to the primers that contained AgeI and KpnI sites . The cloned plasmid DNA was transformed into NEB Stable Competent E. coli, DNA was prepared from single colonies and screened for the correct insert by restriction digestion and sequencing. Endotoxin-free DNA of the cloned plasmids were prepared for large scale production of full-length VAR2CSA vectors using an endotoxin-free high-speed giga prep kit (Qiagen).

Renn J.P., Doritchamou J.Y., Tentokam B.C., Morrison R.D., Cowles M.V., Burkhardt M., Ma R., Mahamar A., Attaher O., Diarra B.S., Traore M., Dicko A., Tolia N.H., Fried M, & Duffy P.E. (2021). Allelic variants of full-length VAR2CSA, the placental malaria vaccine candidate, differ in antigenicity and receptor binding affinity. Communications Biology, 4, 1309.

+ Open protocol

+ Expand

HK2 Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following primers: forward, 5’-CCGGAATTCGCCACCATGATTGCCTCGCATCTGCTTGCCTACT-3’ and reverse, 5’-CGCGGATCCCTATCGCTGTCCAGCCTCACG GATGC-3’ was used to amplify the full length of HK2. And the HK2 DNA fragment was cloned into pIRES2-AcGFP (Clontech, Mountain View, CA) with the EcoRI and BamHI sites. The short hairpin RNA (shRNA) for HK2 was purchased from Gene Pharma (Shanghai, China). Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was used to transfect the pIRES2-AcGFP-HK2 and shRNA vectors into SiHa and HeLa cells to generate stably transfected cell lines by treating with G418 (Calbiochem, La Jolla, CA, USA) for 3 weeks.

Cui N., Li L., Feng Q., Ma H.M., Lei D, & Zheng P.S. (2020). Hexokinase 2 Promotes Cell Growth and Tumor Formation Through the Raf/MEK/ERK Signaling Pathway in Cervical Cancer. Frontiers in Oncology, 10, 581208.

+ Open protocol

+ Expand

Overexpression of Beclin1 in Hep-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The amplification of Beclin1 gene was performed by polymerase chain reaction (PCR) using the full-length Beclin1 cDNA clone (pCMVsPORT6-Beclin1 from Funeng Genes Co., Ltd, Guangzhou, China) as the template, and then electrophoretic detection was performed. The amplified product was digested with SacI and EcoRI (Promega Corporation, Fitchburg, WI, USA) and purified using the DNA gel recovery kit (Dongsheng Biotech Co., Ltd., Guangzhou, China) according to the manufacturer’s instructions. The target gene Beclin1 was ligated to the expression vector pIRES2-AcGFP (Clontech Laboratories, Inc., Mountain View, CA, USA) and transformed into competent DH5α, and then the cloned recombinants were screened. The recombinant plasmid pIRES2-AcGFP-Beclin1 was extracted with a small-scale plasmid extraction kit from Shanghai Labaide. Finally, the extracted plasmid was transfected into human laryngeal carcinoma Hep-2 cell line (Nanjing KeyGen Biotech, Nanjing, Jiangsu, China) using Lipo2000 according to the manufacturer’s protocol. Hep-2 cells transfected with pIRES2-AcGFP-Beclin1 were considered as the Beclin1 group and Hep-2 cells transfected with pIRES2-AcGFP as the empty vector group, while the control group consisted of the Hep-2 cells not transfected with pIRES2-AcGFP.

Wan B., Zang Y, & Wang L. (2018). Overexpression of Beclin1 inhibits proliferation and promotes apoptosis of human laryngeal squamous carcinoma cell Hep-2. OncoTargets and therapy, 11, 3827-3833.

+ Open protocol

+ Expand

Overexpression of MSNP1AS in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length MSNP1AS was inserted into pIRES2-AcGFP (Clontech) [9 (link)], a mammalian over-expression construct. Each experiment was made up of one pIRES2-AcGFP negative control transfection and one pIRES2-AcGFP-MSNP1AS transfection. Cells were transfected using Amaxa Nucleofector (Lonza, Walkersville, MD, USA) technology, using 2 µg of vector per well, and subcultured into 6-well plates. One milliliter of fresh prewarmed media was added to each well and the cells were centrifuged twice at 130× g for 10 min for the SK-N-SH cells and 300× g for 5 min for the ReNcell CX cells with PBS washes of 7 mL and 4 mL, respectively. The cell pellet was resuspended in Nucleofector solution containing a supplement using 1 × 10⁶ cells per well. One hundred microliters of cell/Nucleofector solution was added to a new cuvette and placed in the Amaxa Nucleofector using the T-16 program. Five hundred microliters of fresh prewarmed media was added to the cuvette, mixed, and transferred to the well with a disposable pipet. A two mL culture medium was added to the transfected cells in the 6-well plate. The cells were incubated at 37 °C in 5% CO₂ until harvest. Each experiment was repeated four times.

DeWitt J.J., Grepo N., Wilkinson B., Evgrafov O.V., Knowles J.A, & Campbell D.B. (2016). Impact of the Autism-Associated Long Noncoding RNA MSNP1AS on Neuronal Architecture and Gene Expression in Human Neural Progenitor Cells. Genes, 7(10), 76.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!