The level of TGF-β in the BrC CMs was analyzed with the human TGF-β Quantikine ELISA kit (R&D Systems, ref. DY240) according to the protocol provided by the manufacturer. To determine the cytokine profile of CMs and sera from patients with BrC, the concentration (in pgs/ml) of G-CSF, GM-CSF, IL-1β, IL-2, IL-4, IL-6, IL-8, IL-10, IL-17, IL-12 p70, Interferon-α2 (INF-α2), MCP-1, RANTES, EGF, VEGF, CXCL12 (also known as SDF-1), and metalloproteinases MMP-1, MMP-2, MMP-7, MMP-9, and MMP-10 were determined with the MILLIPLEX HCYTOMAG-60K kit (EMD Millipore Corp.) following the manufacturer's recommended procedure. The analysis of data was performed in the xPONENT® Software.
Human tgf β quantikine elisa kit
Manufactured by R&D Systems
Sourced in United States
The Human TGF-β Quantikine ELISA kit is a quantitative sandwich enzyme immunoassay designed to measure human transforming growth factor beta levels in cell culture supernates, serum, and plasma samples.
Automatically generated - may contain errors
Lab products found in correlation
Milliplex hcytomag 60k kit, by Merck Group (1 mentions)
Qhsacep0049951, by Bio-Rad (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Human il 2 quantikine elisa kit, by R&D Systems (1 mentions)
Human il 4 quantikine elisa kit, by R&D Systems (1 mentions)
Human il 10 quantikine elisa kit, by R&D Systems (1 mentions)
Human il 12 p70 quantikine elisa kit, by R&D Systems (1 mentions)
Mouse tgf β1 duoset elisa, by R&D Systems (1 mentions)
4 protocols using human tgf β quantikine elisa kit
1
Quantification of Cytokine and Growth Factor Profiles in Breast Cancer
2
Gene Expression Analysis of PRG4 and NOX4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with the ExtractMe total RNA kit (Blirt S.A., Gdańsk, Poland). Reverse transcription was performed (LabQ, Labconsulting, Vienna, Austria). RT-PCR was done (LabQ, Labconsulting, Vienna, Austria) on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA). Primer sequences are hPRG4_F CAGTTGCAGGTGGCATCTC, hPRG4_R TCGTGATTCAGCAAGTTTCATC; hNOX4a_F TCTTGGCTTACCTCCGAGGA, hNOX4a_R CTCCTGGTTCTCCTGCTTGG; hGAPDH_F AAGCCACATCGCTCAGACAC, hGAPDH_R GCCCAATACGACCAAATCC. IL11 primer were from Bio-Rad (qHsaCEP0049951). The mRNA levels were calculated by normalizing to the housekeeping gene GAPDH using the ΔΔCt method after exponential expression transformation. For the immunoassay, the human IL11 and human TGF-β Quantikine ELISA kit was used (R&D Systems, Minneapolis, MN, USA). ELISA data was not normalized to an internal compound.
3
Immunomodulatory Effects of Sera on DC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The effects of sera on the immunomodulatory properties of DC were evaluated by determining IL-2, IL-4, IL-10, IL-12 and transforming growth factor β (TGF-β) levels in cell culture supernatants. The following ELISA kits were used: Human IL-2 Quantikine ELISA Kit, Human IL-4 Quantikine ELISA Kit, Human IL-10 Quantikine ELISA Kit, Human IL-12p70 Quantikine ELISA Kit, and Human TGF-β Quantikine ELISA Kit (all obtained from R&D Systems, Minneapolis, Minnesota, USA) according to the manufacturer’s instructions.
4
TGFβ1 Measurement in Mammosphere Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TGFβ1 was measured in the conditioned medium of E‐cadherin‐RFP/Py2T cells using human TGFβ Quantikine ELISA kit and mouse TGFβ1 Duoset ELISA (R&D Systems Inc., Minneapolis, MN, USA, Cat# DB100B and Cat# DY1679‐05, respectively), according to the manufacturer’s instructions. Conditioned medium was collected from approximately 80 3D mammospheres and after 1 : 10 dilution was analyzed by ELISA. For human TGFβ1 ELISA, stem cell or 2D cell culture media were used as negative controls. For mouse TGFβ1 ELISA, 2 ng·mL−1 human TGFβ1 was used as negative control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!