The largest database of trusted experimental protocols

4 protocols using primers forward and reverse

1

PCR Amplification of Plastid and Nuclear Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Based on total DNA isolates, target regions were amplified using the primers listed in Table 2. The PCR of all plastid markers was carried out in accordance to the Shaw et al. (2007) (link) “slow and cold” protocol, whereas nuclear markers were amplified due to the Sabovljević & Frahm (2011) recommendations. In all cases the total volume of PCR mixture was 20 μL and comprised of REDTaq DNA Polymerase (0.05 U/μL) (Sigma-Aldrich, St. Louis, MO, USA), 1× REDTaq Reaction Buffer containing MgCl2 (Sigma-Aldrich, St. Louis, MO, USA), primers forward and reverse (0.2 μm each primer) (Sigma-Aldrich, St. Louis, MO, USA), dNTPs solution (200 μm each dNTP) (Sigma-Aldrich, St. Louis, MO, USA), BSA (0.1 mg/mL) (New England BioLabs, Ipswich, MA, USA), one μL template DNA and water. The PCR products were run on agarose gel under the same conditions as DNA extracts (see above). All amplicon lengths included in the text are evaluated based on the mentioned gel electrophoresis (data not shown). I did not use any further improvement of selected PCR protocols, as long as my goal was to check the general feasibility of obtaining PCR-amplifiable DNA after Qiagen Kit and CTAB extractions.
+ Open protocol
+ Expand
2

Analyzing NANOG Promoter Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Methylation status of the promoter region of NANOG was analyzed using Sanger sequencing after bisulfite conversion. Bisulfite conversion was performed using the innuCONVERT Bisulfite Basic Kit (Analytik Jena AG, Jena, Germany) according to the manufacturer's instructions using 500 ng of DNA.
PCR reaction contained 0.2 μl 5 μM primers (forward and reverse) (Sigma-Aldrich, Taufkirchen, Germany), 0.05 μl (5 units/μl) HotStarTaq Plus DNA Polymerase, 1 μl 10x PCR Buffer, 0.7 μl (3.33 mM) dNTPs, 6.35 μl ddH2O (Qiagen, Hilden, Germany), and 15 ng bisulfite-converted DNA. Thermal conditions for PCR were as follows: 10 min at 95°C, 40 cycles of 1 min at 95°C, 1 min at 61°C, 1 min at 72°C, and final elongation for 10 min at 72°C. Primers used are listed in Additional file 1: Table S1.
Sanger sequencing was performed on SeqStudio Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). PCR products were directly used for a sequencing reaction after being purified with ExoSAP-IT™ PCR Product Cleanup Reagent (Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions. The sequencing reaction was performed using Big-Dye terminator chemistry version 1.1 (Applied Biosystems, Foster City, CA, USA). Electropherograms were analyzed using the Sequence Scanner Software 2, Version 2.0 (Applied Biosystems, Foster City, CA, USA).
+ Open protocol
+ Expand
3

Quantification of TYMS mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
To determine TYMS mRNA levels, a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Barcelona, Spain) was used. The reaction was performed in a final volume of 20 μL, containing 1× SYBR Universal PCR Master mix (Applied Biosystems, Barcelona, Spain), 0.25 μM of reverse and forward primers (Sigma- Aldrich, Madrid, Spain), 3 μL of cDNA and H2O mQ. PCR cycling conditions were 10 min denaturation at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. The mRNA quantification was performed using the ΔΔCt method, where Ct is the threshold cycle that corresponds to the cycle where the amount of amplified mRNA reaches the threshold of fluorescence. Cyclophylin B (PPIB) was used as an endogenous control to normalize the results. Primer sequences for RT-qPCR are detailed in Table 1.
+ Open protocol
+ Expand
4

qRT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA levels were determined by SYBR-Green Real-Time PCR in a final volume of 20 μl, containing 1× SYBR® Select Master Mix (Life Technologies), 0.25 μM of reverse and forward primers (Sigma-Aldrich), 2 or 3 μl of cDNA and H2O mQ up to 20 μl. PCR cycling conditions were 10 min denaturation at 95 °C, 40 cycles of 15 s at 95 °C and 1 min at 60 °C, followed by dissociation stage for 15 s at 95 °C, 20 s at 60 °C and 15 s at 95 °C.
Fold changes in gene expression were calculated using the comparative CT (ΔΔCT) method, where CT is the threshold cycle number at which fluorescence of amplified mRNA passes the threshold. GAPDH levels were used as endogenous controls. All the primers used in these experiments are detailed in Table 2.

Sequences of the primers used in the qRT-PCR and the amplified product sizes

Target geneForward sequence (5′-3′)Reverse sequence (5′-3′)Product size (bp)
GAPDHCCATGTTCGTCATGGGTGTGAACCAGCCAGTAGAGGCAGGGATGATGTTC251
CD14GCAGCCGAAGAGTTCACAAGCGCGCTCCATGGTCGATAAG129
CD47GAGTCTCTGTATTGCGGCGTGGGGGTTCCTCTACAGCTTTCC161
IL-1βGTGGCAATGAGGATGACTTGTTCTAGTGGTGGTCGGAGATTCGTA124
IL-18CCTCAGACCTTCCAGATCGCTTCCAGGTTTTCATCATCTTCAGC159
IL-6CATTTGTGGTTGGGTCAGGAGTGAGGAACAAGCCAGAGC112
IL-8CCACCGGAAGGAACCATCTCTTCCTTGGGGTCCAGACAGA279
Mcl-1GACGAGTTGTACCGGCAGTCGTTGATGTCCAGTTTCCGAAGC200
SIRPαAAATACCGCCGCTGAGAACATGTCCTGTGTTATTTCTCTGGCA197
TNF-αGCCAGAGGGCTGATTAGAGTCAGCCTCTTCTCCTTCCTG124
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!