The largest database of trusted experimental protocols

Mir 210 miscript primer assay rn mir 210 1

Manufactured by Qiagen

The MiR-210 miScript Primer Assay (Rn_miR-210_1) is a laboratory equipment product designed for the detection and quantification of the miR-210 microRNA in rat samples. The assay provides the necessary components to perform real-time PCR analysis of miR-210 expression levels.

Automatically generated - may contain errors

2 protocols using mir 210 miscript primer assay rn mir 210 1

1

Quantification of miR-210 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-210 levels were determined by miScript II RT kit (Qiagen) and miScript SYBR Green PCR kit with miScript Primer Assay kit (Qiagen) according to manufacturer's instructions. Primers included miScript Universal Primer, miR-210 miScript Primer Assay (Rn_miR-210_1; Cat#MS00000644; Qiagen) and SNORD61 miScript Primer Assay (Hs_SNORD61_11; Cat#MS00033705; Qiagen). Briefly, 1 μg of template RNA was mixed with reverse-transcription master mix in a final volume of 20 μl and incubated for 60 minutes at 37°C, and the reaction was stopped at 95°C. Two nanograms of template cDNA were used for miR-210 quantification in a final volume of 25 μl system containing specific primers and QuantiTect SYBR Green PCR master mix following manufacturer's instructions. Primers included miScript Universal Primer, miR-210 miScript Primer Assay and SNORD61 miScript Primer Assay (Qiagen). Serial dilutions of the positive control were done on each plate to create a standard curve for the quantification. PCR was done in triplicate and threshold cycle numbers were averaged for each sample.
+ Open protocol
+ Expand
2

Quantifying Cardiac Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from whole fetal hearts or cultured cardiomyocytes using TRIzol reagent (Life Technologies). Isolated RNA was converted to cDNA using the SuperScript III First-Strand Synthesis SuperMix (Life Technologies) for GR mRNA detection, or miScript II RT kit (Qiagen) for miR-210 detection according to the manufacturer's instructions. GR mRNA levels were detected using the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA). Primers included: GR, Forward: AGGTCTGAAGAGCCAAGAGTTA; Reverse: TGGAAGCAGTAGGTAAGGAGAT; and Actin: Forward: TCAGGTCATCACTATCGGCAAT; Reverse: ACTGTGTTGGCATAGAGGTCTT. MiR-210 levels were detected using the miScript SYBR Green PCR kit (Qiagen). Primers included miScript Universal Primer, miR-210 miScript Primer Assay (Rn_miR-210_1; Cat#MS00000644; Qiagen) and SNORD61 miScript Primer Assay (Hs_SNORD61_11; Cat#MS00033705; Qiagen). PCR was done in triplicate and threshold cycle numbers were averaged for each sample. The values were expressed as fold of normoxia.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!