qPCR was performed using the Taqman RNA Amplification kit or the LightCycler Multiplex RNA Virus Master and a LightCycler 480 instrument (Roche). Raw data were analyzed using the fit points method and fold change was calculated with the Delta-Delta Cp method using the housekeeping gene EEF1A1 (EF1) as a reference. Primers and fluorescent probes were designed using Primer3 and purchased from Eurogentec. A Taqman Gene Expression assay was used for RUNX3 (Hs00231709_m1, Thermo Fisher) and PLZF (ZBTB16, Hs00232313_m1, Thermo Fisher) analyses. Oligonucleotide sequences are presented as Supplementary file 2c .
Taqman rna amplification kit
Manufactured by Roche
The TaqMan RNA Amplification Kit is a laboratory instrument used for the amplification and detection of RNA molecules. The kit provides reagents and protocols for the reverse transcription and quantitative polymerase chain reaction (RT-qPCR) of RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using taqman rna amplification kit
1
Quantitative PCR Gene Expression Analysis
2
Dengue RNA Isolation and Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dengue RNA was isolated from plasma using the High Pure Viral RNA Acid kit from 03730964001, Roche Diagnostics GmbH, Mannheim, Germany. The purified viral RNA is free of intact virus, nucleases, and all cellular components that interfere with RT-PCR. Selection of primers and probe for TaqMan-based RT-PCR for detection of DEN Primers and 5' nuclease probes were designed using DNA database entries. All sequences available from the European Molecular Biology Laboratory (EMBL), GenBank, and DNA Data Bank of Japan (DDBJ) databases (accessed autumn 2000) were included in the search for possible primer binding regions.[14 (link)] The TaqMan RNA Amplification Kit (04331885001, Roche Diagnostics GmbH, Mannheim, Germany) was used for amplification. It contains RNA MIX and Mn2+ reagents designed for reverse transcription and PCR amplification of target RNA in a real-time fluorescent detection assay.
The extension cycle time was added onto annealing cycle time as the same temperature was used for both steps.
The final sequences of probes and primers are given inTable 1 .
The extension cycle time was added onto annealing cycle time as the same temperature was used for both steps.
The final sequences of probes and primers are given in
3
Quantifying mRNA Levels in moDCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA content of 2 × 105 moDCs was isolated with the MagNA Pure LC mRNA isolation kit (Roche) on the MagNA pure instrument (Roche Applied Science) following manufacturer’s indications. TNF, IL-6, IL-8, and IL-1β mRNAs were quantified by real-time PCR using TaqMan RNA Amplification Kit (Roche) or LightCycler Multiplex RNA Virus Master (Roche) on a LightCycler 480 instrument (Roche Applied Science). Primers and probes were synthesized by Eurogentec (Actb: F: ggatgcagaaggagatcactg, R: cgatccacacggagtacttg, probe: ccctggcacccagcacaatg; Ctsb: F: tcccaccatcaaagagatca, R: atgcagatccggtcagagat, probe: tgtggctcctgctgggcctt; Syk: F: cagggaatatgtgaagcagaca, R: tccagctgaggcttctgact, probe tcaggctctggagcaggcca; IL1b: F: acagatgaagtgctccttcca, R: gtcggagattcgtagctggat, probe: ctctgccctctggatggcgg; IL6: F: gacagccactcacctcttca, R: agtgcctctttgctgctttc, probe: cctcgacggcatctcagccc; CXCL8/IL8: F: gccttcctgatttctgcagc, R: actgacatctaagttctttagcactcc, probe: tggcaaaactgcaccttcacacag, TNF: F: cccagggacctctctctaatc, R: atgggctacaggcttgtcact, probe: tggcccaggcagtcagatcatc). mRNA levels were normalized to β-actin mRNA expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!