Sybr green premix pro taq hs qpcr kit

RSC96 was washed with cold PBS after treatment. RNAiso Plus was applied to extract total RNA and the detective values of OD260/280 were used to quantify total RNA. Evo M-MLV RT Kit with gDNA Clean for qPCR was used to reverse transcription according to the manufacturer’s protocol. Amplification was performed in the CFX Connect Real-Time PCR Detection System (BIO-RAD, Hercules, CA, United States) following the protocol of SYBR® Green Premix Pro Taq HS qPCR Kit. The reaction procedure was as follows: one cycle at 95°C for 30 s for predenaturation and 40 cycles at 95°C for 5 s and at 60°C for 30 s for reaction. The primer GAPDH (B661204) was purchased from Sangon Biotech. Co., Ltd. (Shanghai, China) and the primers of TNF-α IL-6 and IL-1β were also designed by them which were listed in Table 1. The 2−ΔΔCT method was used to analyze expression levels of TNF-α IL-6 and IL-1β. Each sample was measured three times and averaged.

PCRRAW264.7 cells were inoculated at a concentration of 4 ×10⁵ per well and cultured in DMEM at 37 °C and 5% CO₂ for 24 h, followed by treatment of the different concentrations of ALA (50 μM, 100 μM, 200 μM) in OCM for 24 h in the same culture conditions. After centrifugation, the cells were collected. RNA-easy Isolation Reagen was used to extract total RNA from each group of cells, and Trizol reagent was used to extract total RNA from each group of tibiae. Then, 2 μg of RNA was extracted for cDNA synthesis using the iScript cDNA synthesis kit.RT-qPCR was performed using the SYBR^® Green Premix Pro Taq HS qPCR kit and detected using the CFX96 Touch Real-Time PCR Detection System (BIO-RAD, Hercules, CA, USA) (95 °C for 30 s, 95 °C for 5 s, 60 °C for 5 s, for 40 cycles). β-actin were used as the internal standard to determine the relative values of RAW264.7 cells mRNA expression (the primer sequences are presented in detail in Table 1), while housekeeping gene Gapdh of rat cells were used as the internal standard (the primer sequences are presented in detail in Table 2). The results were obtained by the 2^−ΔΔCt method.

PtSMXL gene expression profiles were analyzed in roots, young leaves, mature leaves, young stems, mature stems, and dormant axillary buds of 84 K poplar. In addition, the response of PtSMXL genes to GR24 was studied in seedlings treated with six concentrations (0, 2, 5, 10, 15, or 20 μM) of GR24, and PtSMXL expression profiles during axillary bud growth were examined in axillary buds at six different stages after the begins of axillary bud growth (0, 1, 3, 5, 7, and 10 days). The more detailed description of materials is presented in the Plant materials section. Total RNA was isolated from each sample using a SteadyPure Plant RNA Extraction Kit AG21019 (Accurate Biotechnology [Hunan] Co., Ltd) and then quality-checked on a NanoDrop One UV spectrophotometer (Thermo Scientific, USA). First-strand cDNA synthesis was carried out with DNA-free RNA using Evo M-MLV Plus 1st Strand cDNA Synthesis Kit AG11615 (AG). Real-time quantitative PCR (qRT-PCR) was performed using a SYBR Green Premix Pro Taq HS qPCR Kit AG11701 (AG) on a CFX-96 real-time PCR detection system (Bio-Rad, USA). Each experiment consisted of three independent biological replicates, with three technical replicates per sample. The β-actin gene was used as an internal control. Relative expression levels of each target gene were analyzed the 2^-∆∆CT method [41 (link)]. Sequences of all primers used are listed in Table S6.

Total RNAs of approximately 40 zebrafish embryos at 48 h post fertilization (hpf) were extracted as previously described^{76 (link),77 (link)}, and were then reverse transcribed (TaKaRa, PrimeScriptTM RT-PCR kit DRR014A) to obtain cDNAs for use as Quantitative Real-time PCR (qPCR) templates. The qPCR assays were performed (Accurate Biology, SYBR Green Premix Pro Taq HS qPCR Kit) using a CFX96 real-time system (Bio-Rad), and the expression level of β-actin in zebrafish embryos was used as an internal control. The primer sequences used were as follows:
LKB1 Forward: GTGAAGGAGATGCTGGACTCGG
LKB1 Reverse: CAGCACGTCCACCAGCTGAATG
ACTIN Forward: GTACCCTGGCATTGCTGAC
ACTIN Reverse: CTGCTTGCTGATCCACATCTG