Orca r2 camera

Activation of KillerRed was conducted on the TillPhotonics/FEI iMIC digital spinning disk microscope (FEI Munich) with the widefield modus (WF Stingray F-145B) under stable environmental conditions (37 °C and 5% CO₂). Time-lapse acquisition was performed with a 60×/1.35 NA oil-immersion objective from Olympus and the Hamamatsu ORCA-R2 camera. The binning was set to 2 × 2 pixel. Photo-activation was performed with 20% laser power of a 561 nm laser diode in a diffraction-limited ROI after acquiring two pre-activation images. The dwell time was set to 1.0 ms/µm² and the line overlap to 41%. KillerRed was activated at 24 hpi and parasites were imaged overnight (16 h).

Ex vivo isolated macrophages or starved RAW246.7 cells (40000 cells/well) were placed into the upper chamber of a 24-multiwell insert system with 5-μm pore size polycarbonate filter (Corning). Cell migration was stimulated with VEGF-A or PLGF-1 (100 ng/mL) added to the starvation medium into the lower chamber, in presence of iVR1 (2 μM, 10 μM or 50 μM) or CP (50 μM). After 24 h for RAW246.7, or 6 h for peritoneal macrophage, cells on the top of the filter were removed and those on the bottom side were stained with DAPI. Images were recorded on Leica DMI 6000 microscope equipped with Hamamatsu Orca R2 camera. Single cells were counted using Tile Scan Macro of LAS AF Software (Leica).

Fluorescence‐conjugated piR‐rno‐63076 probes (5′‐CGTGGTTCTACCCTGTGGTA‐3′) were synthesized by (Exon, Guangzhou, China) and used for RNA‐FISH. Hybridization was performed using RNA‐FISH kit (Exon) according to the manufacturer's instructions. Finally, the FISH sections were incubated with DAPI for 10 minutes. And then the images were recorded using a Hamamatsu ORCA‐R2 camera (Hamamatsu Photonics) and recorded by LAS AF software (Leica).

Endothelial cell migration was studied as previously described (Alvarez-García et al., 2013a (link)). Briefly, HUVEC control or melatonin treated for a week cells were cultured into 6-well plates (Falcon) in VCBM supplemented with 2% FBS and were allowed to reach full confluence. With a pipette tip a line of cells was scraped away. Then, cells were washed with PBS and irradiated. In the plates, four randomly selected views along the scraped line were photographed using an ORCA R2 camera (Hamamatsu Photonics, Massy Cedex, France) attached to a microscope set Nikon Ti (Werfen Group, Barcelona, Spain) at 10 × magnification. Photomicrographs were taken every 10 min during the course of the experiment, which was terminated as soon as the wound was completely filled in vehicle treated controls (after 10 h). Initial and final wound sizes were measured using the Nis Elements v.3.8 software (Nikon, Tokyo, Japan) and the difference between the two was used to determine migration distance using the following formula: initial wound size minus final wound size divided by two.

Slides were fixed and permeabilized in methanol at − 20 °C for 20 min and stored at − 80 °C. Prior to staining, slides were blocked for 1 h at room temperature with 1% bovine serum albumin (BSA)/PBS. Slides were washed with PBS and incubated for 1 h with mouse anti-PfHRP2 antibody 3A4 (1 mg/mL) conjugated to Alexa Fluor-594 diluted 1:200 in 1% BSA/PBS. After washing, slides were incubated with a rabbit anti-Plasmodium enolase antibody diluted 1:50 in 1% BSA/PBS. Slides were washed and incubated for 1 h with Alexa Fluor-488 labeled goat anti-rabbit IgG (Invitrogen), diluted 1:500 in 1% BSA/PBS. Slides were washed and briefly dried. ProLong Gold antifade reagent with DAPI (ThermoFisher) was added to the wells and sealed under a coverslip. Images were captured with the Zeiss AxioImager M2 microscope equipped with a Hamamatsu Orca R2 camera. Deconvolution and image analysis were done using the Velocity Imaging Software. Approximately 1500 RBCs were counted for each human patient (n = 6) to determine the percentage of PfHRP2 positive, DAPI negative, once-infected RBCs.

HUVEC control or melatonin 1 mM, treated for a week, cells were cultured into 6-well plates (Falcon) in VCBM enriched with 2% FBS and were allowed to reach full confluence. Based in previous works^{23 (link)}, a line of cells was scraped away in each plate using a pipette tip. Cells were washed with PBS and docetaxel 10 nM or vinorelbine 10 nM or its diluent (ethanol at a final concentration lower than 0.001%) was added to each plate. After that, four randomly selected views along the scraped line in each plate were photographed using an ORCA R2 camera (Hamamatsu Photonics, Massy Cedex, France) attached to a microscope set Nikon Ti (Werfen Group, Barcelona, Spain) at 10x magnification. Photomicrographs were taken every 10 minutes until the wound was completely filled in controls (after 10 hours). Initial and final wound sizes were determined using the Nis Elements v.3.8 software (Nikon, Tokyo, Japan) and the difference between the two was used to determine migration distance using the following formula: initial wound size minus final wound size divided by two.