Genomic DNA was isolated from B-cell clones with a commercial kit (QIAGEN). For
analysis of the camel-like antibody MGB47, 3’RACE22 (
link) with the CH2-γ-REV1 primer (gagaccttgcacttgtactccttgcc) was used for
amplification of truncated heavy chain mRNAs. Heavy-chain variable to constant gDNA of
MGB47 was amplified using an upstream 5’ VH3-21 primer
(gggtccatattgtgatcctgagtctggg) and CH2-γ-REV1 as the reverse primer. After PCR
amplification with
LongAmp Taq Polymerase (New England Biolabs), the 6000bp amplicon was
cloned into a vector using the
TOPO XL PCR cloning kit (ThermoFisher) and sequenced by
plasmid-NGS-sequencing (Microsynth, Switzerland). All other LAIR1 switch and V-DJ inserts
were analyzed by PCR amplification of gDNA and Sanger Sequencing using donor-specific
forward and universal reverse primers: donE_FW (cctggagggtcttctgcttgctggc), donF_FW
(cctcctgctggtggcagctccc), donJ/M_FW1 (atggagtttgggctgagctgggttttcc), donJ_FW2
(gtgagtgaacacgagtgagagaaacagtgg), donM_FW2 (gagtgaacatgagtgagaaaaactggatttgtgtgg),
donO/Q_FW (atgaaacatctgtggttctt), 3’J6_REV (ggcatcggaaaatccacagaggctcc),
IgG_CH1_REV1 (tcttgtccaccttggtgttgct), IgG_CH1_REV2 (gtagtccttgaccaggcagc), IgM_CH2_REV1
(ggacacctgaatctgccggggactgaaaccc), and IgM_CH2_REV2 (ctggtcaccttgtaggtcgtgggcccag).
Pieper K., Tan J., Piccoli L., Foglierini M., Barbieri S., Chen Y., Silacci-Fregni C., Wolf T., Jarrossay D., Anderle M., Abdi A., Ndungu F.M., Doumbo O.K., Traore B., Tran T.M., Jongo S., Zenklusen I., Crompton P.D., Daubenberger C., Bull P.C., Sallusto F, & Lanzavecchia A. (2017). Public antibodies to malaria antigens generated by two LAIR1 insertion modalities. Nature, 548(7669), 597-601.