Log In Sign up
The largest database of trusted experimental protocols

E1910

Manufactured by Promega
Visit Supplier
Sourced in United States, China, Germany

The E1910 is a laboratory instrument designed for automated nucleic acid extraction and purification. It utilizes magnetic particle technology to efficiently isolate DNA, RNA, or other biomolecules from a variety of sample types. The E1910 is capable of processing multiple samples simultaneously, providing a streamlined and high-throughput solution for researchers and laboratories.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (38 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (23 mentions) Dual luciferase reporter assay system, by Promega (9 mentions) Glomax 20 20 luminometer, by Promega (8 mentions) E2241, by Promega (8 mentions) Psicheck 2 vector, by Promega (7 mentions) Prl tk, by Promega (7 mentions) E1330, by Promega (6 mentions) E1751, by Promega (5 mentions) Pmirglo vector, by Promega (5 mentions) Pmirglo, by Promega (4 mentions) Turner biosystems luminometer reader, by Promega (4 mentions) Magna rip kit, by Merck Group (4 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (4 mentions) Fugene hd, by Promega (3 mentions) Glomax, by Promega (3 mentions) Lipofectamine kit, by Thermo Fisher Scientific (3 mentions) Microplate luminometer, by Berthold Technologies (3 mentions) Plasmid puri cation kit, by Thermo Fisher Scientific (3 mentions) Hek293 cell, by American Type Culture Collection (3 mentions)

276 protocols using e1910

1

AhR Transcriptional Activity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
AML12 cells were seeded in a 24-well plate and cultured for 12 hours before transfection with Ahr reporter plasmid (kindly provided by Professor Dalei Wu, Shandong University, China)67 (link) and pRL-TK Vector (E2241; Promega, Madison, WI). After 24 hours, cells were treated with AHR agonists (suspended in DMSO initially and diluted with medium). With another 24 hours of incubation, cells were washed with PBS and then lysed with lysis buffer (E1910; Promega). Luciferase activity was measured using a microplate reader (Tecan Spark, Männedorf, Switzerland) after adding luciferase reagent (E1910; Promega).
Qian M., Liu J., Zhao D., Cai P., Pan C., Jia W., Gao Y., Zhang Y., Zhang N., Zhang Y., Zhang Q., Wu D., Shan C., Zhang M., Schnabl B., Yang S., Shen X, & Wang L. (2021). Aryl Hydrocarbon Receptor Deficiency in Intestinal Epithelial Cells Aggravates Alcohol-Related Liver Disease. Cellular and Molecular Gastroenterology and Hepatology, 13(1), 233-256.
+ Open protocol
+ Expand
2

Oxidative Stress Modulates ARE Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ARE fluorescence activity was tested in cultured BMEC with or without H 2 O 2 via an ARE reporter gene according to the manufacturer's instructions (Promega). In brief, after the treatment of BMEC with H 2 O 2 (600 μM) for 0, 6, 12, and 24 h, 50 μL of luciferase assay reagent II was added to the BMEC, followed by 10 μL of cell lysis buffer. The activity of relative light unit 1 (RLU1) was detected with a biluciferase reporter gene kit (E1910; Promega). Then, 50 μL of 50× Stop and Glo reagent was added to the BMEC, and the activity of relative light unit 2 (RLU2) was detected again with a biluciferase reporter gene kit (E1910; Promega). The RLU1/RLU2 ratio was used to determine the transfection efficiency of ARE.
Ma Y.F., Wu Z.H., Gao M, & Loor J.J. (2018). Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro. Journal of dairy science, 101(6).
+ Open protocol
+ Expand
3

NF-κB Luciferase Assay in Transfected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
25,000 cells were plated in 24 well plates and co- transfection was carried out with 1 μg pCAG or pCAG-Flag SETD6 wt plasmid and 1 μg NFκB-luciferase plasmid (pGL3-NF-κB luc) together with Renilla plasmid (10 ng). Cells were lysed with 100 μl of 1X passive lysis buffer followed by freeze thaw cycles to ensure complete lysing of cells. Cells were then scraped by a scraper and collected in Eppendorf tubes and dual luciferase assay was performed according to the manufacturer's protocol (E1910, Dual-Luciferase® Reporter Assay, and Promega). Samples were measured in triplicates.
Mukherjee N., Cardenas E., Bedolla R, & Ghosh R. (2017). SETD6 regulates NF-κB signaling in urothelial cell survival: Implications for bladder cancer. Oncotarget, 8(9), 15114-15125.
+ Open protocol
+ Expand
4

Dual-Luciferase Assay for ATX-3 Transcriptional Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
ATX-3+/+ and ATX-3-/- MEF cells were co-transfected with the indicated reporter constructs PG13 and the internal control Renilla luciferase pRL-null (pRL-CMV, Promega) at a ratio of 8:1 using PEI. Luciferase assays were performed using a dual-luciferase reporter assay system (E1910, Promega) according to the instructions of the manufacturer. Data were normalized for activity of Renilla luciferase to account for transfection efficiency. The assays were performed in duplicate, and data represent the average of five independent experiments.
Liu H., Li X., Ning G., Zhu S., Ma X., Liu X., Liu C., Huang M., Schmitt I., Wüllner U., Niu Y., Guo C., Wang Q, & Tang T.S. (2016). The Machado–Joseph Disease Deubiquitinase Ataxin-3 Regulates the Stability and Apoptotic Function of p53. PLoS Biology, 14(11), e2000733.
+ Open protocol
+ Expand
5

Transient Luciferase Assay for OsAP2-39

Check if the same lab product or an alternative is used in the 5 most similar protocols
The OsAP2-39 promoter (~1500 bp) was inserted into vector pGreen II 0800 containing the luciferase reporter gene (LUC) to generate a reporter vector, and the CDS of OsDREB2B was inserted into the Flag vector to generate the effector vector. Subsequently, the reporter vector was co-transformed via PEG into rice protoplasts together with an empty Flag vector (negative control) or the effector vector (Flag-OsDREB2B) (Yoo et al., 2007 (link)). After culturing at 28°C for 12–14 hours, LUC and reniral siferase (REN) activity levels of rice protoplasts were measured using the dual luciferase reporter assay system (E1910, Promega). The transient expression of LUC driven by the OsAP2-39 promoter was normalized to the expression of the internal control reporter (REN).
Ma Z., Jin Y.M., Wu T., Hu L., Zhang Y., Jiang W, & Du X. (2022). OsDREB2B, an AP2/ERF transcription factor, negatively regulates plant height by conferring GA metabolism in rice. Frontiers in Plant Science, 13, 1007811.
+ Open protocol
+ Expand
6

Validating LINC01232-miR-181a-5p Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Potential 3’UTR-specific binding sites of LINC01232 for miR-181a-5p were predicted by LncBase Predicted v.2 (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=site/page&view=software), and the 3’UTR sequence of LINC01232 was obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/). Then, wild-type or mutant-type LINC01232-3’UTR was inserted into pmiRGLO vector (E1303, Promega, USA) to acquire LINC01232-WT and LINC01232-MUT pmiRGLO plasmids.
SW-620 or LOVO cells were seeded in a 6-well plate (3 × 105/well). When the cell confluence reached 70-80%, LINC01232-WT or LINC01232-MUT plasmid and miR-181a-5p mimic or mimic control were co-transfected into SW-620 or LOVO cells. The luciferase activity was measured by using a dual-luciferase reporter gene detection system (E1910, Promega) 48 h after transfection.
Yuan Y, & Long Z. (2022). LncRNA LINC01232 Enhances Proliferation, Angiogenesis, Migration and Invasion of Colon Adenocarcinoma Cells by Downregulating miR-181a-5p. Journal of Microbiology and Biotechnology, 33(3), 398-409.
+ Open protocol
+ Expand
7

Validation of miR-181b Binding to MEKK3 3'UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Putative miR-181b binding sites in the MEKK3 gene 3’UTR were predicted by the TargetScan algorithm. Individual wild-type or mutant binding site sequence was generated by annealing the forward and reverse oligonucleotides containing Xhol and Xbal sticky ends. The double-stranded oligonucleotides were ligated into the pcDNA3.1 (+) Luciferase vector, by using T4 DNA ligase. HUVECs were plated on 12-well plates at 60, 000/well up to 70%−80% confluency and transfected with 100 ng of wild-type or mutant MEKK3 reporter constructs and 10 ng Renilla plasmid (E2231, Promega). NS-m or 181b-m was co-transfected at 10 nM final concentration for 12 hours. Transfected cells were collected in 200 μl reporter lysis buffer (E1910, Promega) and luciferase activity was measured using a Dual-Luciferase reporter assay system (E1910, Promega). Each reading of luciferase activity was normalized to the Renilla activity.
Zhou H., Yang D., Cheng H.S., McCoy M.G., Pérez-Cremades D., Haemmig S., Wong D., Chen L, & Feinberg M.W. (2022). miR-181b regulates vascular endothelial aging by modulating a MAP3K3 signaling pathway. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 36(6), e22353.
+ Open protocol
+ Expand
8

Luciferase Reporter Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The luciferase reporter assay was carried out according to the manufacturer’s instructions (Promega, E1910).
Liu L., Lu J.Y., Li F., Xing X., Li T., Yang X, & Shen X. (2019). IDH1 fine-tunes cap-dependent translation initiation. Journal of Molecular Cell Biology, 11(10), 816-828.
+ Open protocol
+ Expand
9

NMT1 3'UTR Regulation in HEK293 Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells (CL-0001, Procell Life, China) were incubated in minimum essential medium (MEM; PM150467, Procell, China) containing 1% P/S and 10% FBS. A reporter vector (E1330, Promega Corporation, Madison, WI, USA) with human NMT1 3′-untranslational region (UTR) sequences was constructed to obtain wild-type NMT1 (NMT1-WT; AAAACAGAGGAAATAACACG), whereas the other reporter vector with mutative NMT1 (NMT1-MUT; CCCCCCACAACCCTCCCCCG) 3′-UTR sequences in the SPI1 promoter region was considered as the NC. NMT1-WT or NMT1-MUT and SPI1 overexpression plasmid were transfected into HEK293 cells for 24 h. The luciferase activity was accessed by a dual-luciferase reporter assay system (E1910, Promega, USA) [20 (link)].
Qiu P., Li X., Gong M., Wen P., Wen J., Xu L, & Wang G. (2023). SPI1 Mediates N-Myristoyltransferase 1 to Advance Gastric Cancer Progression via PI3K/AKT/mTOR Pathway. Canadian Journal of Gastroenterology & Hepatology, 2023, 2021515.
+ Open protocol
+ Expand
10

Cloning and Luciferase Assay of CASP1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The proximal promoter region (1.5 kb) of CASP1 gene was cloned into the pGL3 vector using the following PCR primers for genomic DNA amplification: the forward primer, 5′-CTAGGCTAGCACAGCAGCACTCCATTACTCAGTA-3′ and the reverse primer, 5′-GCCCTCGAGTAGCCTGCATCAGGTAGTGTATCC-3′. Luciferase reporter assays were carried out using a dual-luciferase reporter assay system (E1910; Promega), according to the manufacturer's instructions.
Huang T., Zhang P., Li W., Zhao T., Zhang Z., Chen S., Yang Y., Feng Y., Li F., Shirley Liu X., Zhang L., Jiang G, & Zhang F. (2017). G9A promotes tumor cell growth and invasion by silencing CASP1 in non-small-cell lung cancer cells. Cell Death & Disease, 8(4), e2726-.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!