Spss 11.5 software for windows

Polymerase chain reaction performed with specific primers of kDNA pattern of L. donovani (F: 5'TCGCAGAACGCCCCTACC3') and (R: 5'AGGGGTTGGTGTAAAATAGG3') (Tuba-Negin, Iran) that produced 615 bp fragment for L. major and 744 bp fragment for L. tropica. Amplification reaction mixture (25 μl) contained 20 μl PCR mixtures (dNTP's, MgCl₂, primers and Taq DNA polymerase) and 5 μl extracted DNA.[13 ]
Amplification performed by a PCR Thermal Cycler-PC 818 (ASTEC, Japan) under the following conditions: Initial denaturation for 5 min at 95°C, followed by 38 cycles of 94°C for 30 s, 60°C for 45 s, 72°C for 60 s, ending by final extension at 72°C for 7 min. In every round of PCR two standard sample for L. major (strain MRHO/IR/75/ER) and for L. tropica (strain MHOM/01/IR/YAZA) as a positive control and distilled water as negative control were used.
Polymerase chain reaction products were analyzed by 1.5% agarose gel electrophoresis and visualized by  Uvitec System DOC-008.XD (UVItec Ltd, Cambridge, UK) after staining with ethidium bromide. 100 bp DNA Ladder was also used as the DNA size marker. Single fragments of 615 bp and 744 bp are indicative of the species L. major and L. tropica, respectively [Figure 2]. Statistical data analysis was performed using Chi-square tests in the software  SPSS 11.5 software for Windows, (SPSS Inc., Chicago, IL, USA).