Exon 2 forward primer 5′-TCTCACCCGTCGGCTCCGCAG -3′ and exon 3 reverse primer 5′-AGGCGAGATCGGGGAGGC-3′ targeting the dog MHC class I DLA-88 alleles (Wagner et al. 2000 (link)) were used for polymerase chain reaction (PCR) amplification. Reactions were performed in 25-μL reaction volumes, each containing 0.625 U PrimeSTAR GXL (Takara Bio), 5 μL of 5× PrimeSTAR GXL buffer, 2 μL of 2.5mM dNTP, 0.3 μL (25 pmol/μL) of each phosphorylated forward and reverse primers, and 1 μL of DNA extract (60–100 ng of genomic DNA). Reaction conditions in a Takara Dice Touch Thermal Cycler were 98°C for 2 min, 30–35 cycles of 98°C for 10 s and 68°C for 45 s, and 68°C for 10 min, with a final hold at 4°C. PCR products were electrophoresed on a 2% agarose gel and visualized with ethidium bromide florescence under UV illumination and then purified by using a QIAquick PCR Purification Kit (Qiagen).
Primestar gxl
Manufactured by Takara Bio
Sourced in Japan, United States, France
PrimeSTAR GXL is a high-fidelity DNA polymerase designed for accurate and efficient PCR amplification of long DNA fragments. It has a proofreading function that can generate PCR products with a low error rate.
Automatically generated - may contain errors
Lab products found in correlation
Ssiii, by Thermo Fisher Scientific (4 mentions)
Ex taq, by Takara Bio (3 mentions)
In fusion hd cloning kit, by Takara Bio (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Nextera xt dna prep kit, by Illumina (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Histrap ff 1 ml column, by GE Healthcare (2 mentions)
Biolane hti 16 vx platform, by Intavis (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Pfuturbo, by Agilent Technologies (2 mentions)
Bioanalyzer 2100 expert, by Agilent Technologies (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Microprep dna kit, by Zymo Research (2 mentions)
Rneasy plant mini kit, by Qiagen (2 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Generacer kit, by Thermo Fisher Scientific (1 mentions)
Poly a tailing kit, by Thermo Fisher Scientific (1 mentions)
La taq, by Takara Bio (1 mentions)
71 protocols using primestar gxl
1
Targeted Amplification of Canine MHC Class I
2
Mapping 3' Termini of M1GS Ribozymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the efficacy of the HH ribozyme cleavage and generation of the intended M1GS RNA, we sought to map the 3′ termini of the M1GS ribozymes from C. beijerinckii_M1GSDisA and _M1GSCcpA. To this end, total RNA was first incubated with polynucleotide kinase (37°C – 2 h) to dephosphorylate the 2′,3′-cyclic phosphate produced by HH cleavage. The RNA was then polyadenylated using the poly(A) Tailing Kit (Invitrogen, Carlsbad, CA, United States). Subsequently, the RNA was reverse transcribed using SuperScript II (Invitrogen) and the anchored oligo dT primer from the GeneRacer Kit (Invitrogen). The resulting cDNAs were then treated with RNase H before amplifying by PCR the 3′ ends of the ribozymes with M1GS-3F and the GeneRacer 3′ Primer using PrimeSTAR GXL (Takara Bio USA, Mountain View, CA, United States). This step was followed by a round of nested PCR using M1-4F and the GeneRacer 3′ Nested Primer. The nested-PCR RACE product, which migrated close to the expected size on an agarose gel, was then sequenced with the M1-4F primer at the OSU Genomics Shared Resources facility. Sequencing results showed that the HH ribozyme cleaved at the expected position and generated the desired 3′ termini (data not shown).
3
Cloning and Transformation of RDP1 Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RDP1 sequence of Col-0, including the 1,960 bp upstream region from the coding sequence to 661 bp downstream from the stop codon, was amplified using the following primers: 3795_At1g25260F (5′–TTTCTCCCCACATTTCTC–3′) and 3988_At1g25260R (5′–TATGTTATCAAAATTCATAAAATG–3′). The RDP1 sequences from different accessions were amplified from Mz-0, Col-0, Bor-4, and A. lyrata by PCR (PrimeSTAR GXL, Takara Bio, Japan). These PCR products were cloned into pFAST-R01 (Shimada et al., 2010 (link)). Each construct was independently transformed into rdp1-3 (Col-0 background) plants using the floral-dip method (Clough and Bent, 1998 (link)) with Agrobacterium tumefaciens (GV3101).
4
Mutagenesis on Diverse GC-Content Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
We performed dPTP mutagenesis on a range of genomic DNA samples with different levels of G+C content (33-66%) using a Thermococcus polymerase (Primestar GXL; Takara) under a single set of reaction conditions. Mutagenesis and sequencing was performed as described in the method of example 3, except that 10 cycles of “recovery PCR” were performed. As predicted, mutation rates were roughly similar between samples (median rate 7-8%) despite the diversity of G+C content (
5
Quantifying Methylation in GLA Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of DNA from peripheral blood and SFs containing SacII was incubated for 20 h at 37 °C. The digested DNA was then purified by a high pure PCR product purification kit (ref. 11,732,676,001). Purified DNA fragments were used for long PCR amplification with PrimeSTAR GXL (Takara cat# R050A). A pair of primers (forward 5’-AGCGAGACGGTAGACGACGACCAGAACTACTTC-3′, reverse 5’-GGGGTGGGTATCTGGATGAGTAAATATGGGTT-3′) was used to amplify the whole GLA gene 11 kb including the 5’UTRA for all the cases. For HhaI and HpaII sites, 200 ng of DNA were used for the digestion reaction. Purified DNA fragments were used for amplification of exon 1 of the GLA gene for cases 1–9, 32 and 35–36 who had exon 1 mutations by the primers described before [27 (link)]. For other cases that had exon 5–7 mutations, exons 5 to 7 were amplified. All amplified PCR fragments were purified by Wizard SV gel and PCR (Promega), and direct sequencing was performed.
Quantification of methylation was performed based on digestion of mutated or non-mutated alleles by methylation-sensitive restriction enzymes. The quantification of methylation was measured by the Mutation Surveyor Softgenetics software (version 5.1.0). In short, the calculation of methylation of the non-mutated allele was performed in digested fragments as the length of non-mutated allele/ (length of mutated allele+ length of non-mutated allele).
Quantification of methylation was performed based on digestion of mutated or non-mutated alleles by methylation-sensitive restriction enzymes. The quantification of methylation was measured by the Mutation Surveyor Softgenetics software (version 5.1.0). In short, the calculation of methylation of the non-mutated allele was performed in digested fragments as the length of non-mutated allele/ (length of mutated allele+ length of non-mutated allele).
6
Amplification and Sequencing of MSL3 Locus
7
PCR Primer Design and Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR primers for breakpoints estimated from rearrangements were designed using primer3 plus software (Additional file 1 : Table S2). PCR amplification was done using ExTaq, PrimeSTAR GXL, and LATaq (Takara), then amplified products were Sanger sequenced using BioDye Terminator v3.1 Cycle Sequencing kit with 3130xl genetic analyzer (Applied Biosystems, CA, USA).
8
Amplifying and Sequencing Complete HPV16 Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA eluates were subjected to long-template PCR to amplify the complete HPV16 genome. Two overlapping fragments encompassing the complete genome were generated using primer combinations F1832/R6382 and F6201/R2915 (reference 24 (link) and data not shown). PCR was performed using TaKaRa PrimeStar GXL according to the manufacturer's protocol. The cycling conditions consisted of initial incubation at 98°C for 8 min followed by 38 cycles of 98°C denaturation for 15 s, 55°C annealing for 30 s, and 68°C elongation for 5 min and a final elongation step at 68°C for 15 min.
PCR product amplification was verified on the Lonza FlashGel system. If both fragments amplified successfully, samples were treated with ExoSap-It PCR product cleanup (Affymetrix) according to the manufacturer's protocol. If amplification failed for the initial sample, the follow-up sample was excluded from further analyses. If amplification succeeded for the initial sample but failed for the follow-up sample, the infections were sequenced without follow-up. Purified PCR products were subjected to Sanger sequencing using 45 unique primers for HPV16, covering the complete genome in both forward and reverse directions (references 24 (link)– (link)28 (link) and data not shown).
PCR product amplification was verified on the Lonza FlashGel system. If both fragments amplified successfully, samples were treated with ExoSap-It PCR product cleanup (Affymetrix) according to the manufacturer's protocol. If amplification failed for the initial sample, the follow-up sample was excluded from further analyses. If amplification succeeded for the initial sample but failed for the follow-up sample, the infections were sequenced without follow-up. Purified PCR products were subjected to Sanger sequencing using 45 unique primers for HPV16, covering the complete genome in both forward and reverse directions (references 24 (link)– (link)28 (link) and data not shown).
9
KIR Genotyping by SSP-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from buffy coat using the QIA amp DNA Blood Mini kit (Qiagen Ltd, Germany) according to the manufacturer's instructions and quantified using the NanoDrop spectrophotometer. KIR genotyping was carried out using sequence specific primer polymerase chain reaction (SSP-PCR) as previously described [24 (link)]. The mix was composed of 2 μl of DNA polymerase (PrimeStar GXL, Takara Bio Europe, France), 270 μl of αQH2O, 60 μl of 5X buffer, and 9 μl of dNTPs (10 mM) per sample. Briefly, two pairs of sequence specific primers were used to amplify each of 14 functional KIR genes: 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 3DS1, 3DL1, 3DL2, 3DL3, and the pseudogene 2DP1. Amplicons were electrophoresed in 2% agarose gel and visualized under ultraviolet light for the presence or absence of each gene.
10
Constructing pBLU3GREM-EGFP plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pBLU3-EGFP and pME18neo/BLV-Tax-FLAG were described previously [5 (link)]. To construct pBLU3GREM-EGFP, mutations were inserted into pBLU3-EGFP by site-directed mutagenesis using PrimeSTAR GXL (TAKARA BIO, Shiga, Japan) and the mutagenic primer CGCATGCCAGAGATCCTATTT [11 (link), 12 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!