Q5 site directed mutagenesis

Manufactured by New England Biolabs

Sourced in United States

The Q5 site-directed mutagenesis kit is a laboratory tool designed for introducing specific nucleotide changes into DNA sequences. It provides a reliable and efficient method for generating targeted mutations in plasmids or other DNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Q5 Site-Directed Mutagenesis Kit (1720 citations) NEB Q5 Site-Directed Mutagenesis Kit (31 citations) Q5 mutagenesis (18 citations) Q5 Site-Directed Mutagenesis Protocol (12 citations) Q5 site-directed mutagenesis system (9 citations) Q5® Site-Directed Mutagenesis Kit Protocol (9 citations) Site-directed mutagenesis (8 citations) Q5® Hot Start Site-Directed Mutagenesis Kit (3 citations) Q5 site-directed mutagenesis method (3 citations) Q5 Site-Directed Mutagenesis kit and protocol (2 citations)

88 protocols using q5 site directed mutagenesis

Characterization of HNF-1A Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human HNF1A gene in a pcDNA3.1/HisC plasmid (22 (link)) was used in order to subclone two HNF-1A constructs (DD-DBD: residues 1–279, DBD: residues 83–279) into the Gateway donor vector pDONR221 (Invitrogen). An N-terminal Tobacco-Etch Virus protease site (ENLYFQG) was included. In addition, attB1 and attB2 sites were introduced N- and C-terminally of the respective gene fragments, allowing for Gateway cloning strategy. Final expression clones in the destination vector pTH27 (44 (link)) harbored an N-terminal His₆-tag (His₆-(DD-)DBD). MODY3-associated variants (P112L, R263C, N266S) were introduced into (DD-)DBD pTH27 expression plasmids by Q5 site-directed mutagenesis (New England Biolabs). These constructs were used for recombinant protein expression and purification in order to biophysically and functionally characterize HNF-1A variants.
Using the same strategy, the full-length HNF1A gene sequence (residues 1–631) was subcloned into the pcDNA3.1/nV5-DEST mammalian expression vector (Invitrogen), harboring an N-terminal V5-tag. The P112L variant was generated by Q5 site-directed mutagenesis (New England Biolabs). These constructs were used to assess protein stability in a CHX assay.
Primers used in Gateway cloning, Q5 site-directed mutagenesis, and plasmid sequencing are listed in Table S4.

Kind L., Raasakka A., Molnes J., Aukrust I., Bjørkhaug L., Njølstad P.R., Kursula P, & Arnesen T. (2022). Structural and biophysical characterization of transcription factor HNF-1A as a tool to study MODY3 diabetes variants. The Journal of Biological Chemistry, 298(4), 101803.

+ Open protocol

+ Expand

Dual Reporter Generation for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human, heterologous and tricRNA reporters used in this study were described previously (9 (link)). To generate the dual reporter, four point mutations were introduced in the 3′ exon of the tricRNA reporter (see Supplementary Figure S1) using Q5 Site-Directed Mutagenesis (NEB). For primer sequences, see Supplementary Table S1. Additional mutations within the heterologous, tricRNA and dual reporters were also generated using Q5 Site-Directed Mutagenesis (NEB). See Supplementary Table S1 for primer sequences.

Schmidt C.A., Giusto J.D., Bao A., Hopper A.K, & Matera A.G. (2019). Molecular determinants of metazoan tricRNA biogenesis. Nucleic Acids Research, 47(12), 6452-6465.

+ Open protocol

+ Expand

TIAM1 Gene Mutagenesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following TIAM1 human DNA sequence were mutated from GGATCCTCAAG TACCC ACTTCTGCTCAGGG to GGATCGCCAAGTACCCAGCTGCGGCCAGGG using Q5® Site-Directed Mutagenesis (New England Biolabs) according to the manufacturer’s instructions. The following primers were used:

Forward primer: 5′-GGTACTTGGCGATCCTCTGGATGGGCTTGATGAGG-3′

Reverse primer: 5′-CAGCTGCGGCCAGGGAGCTGTTCGCCCTGACCG-3′

Payapilly A., Guilbert R., Descamps T., White G., Magee P., Zhou C., Kerr A., Simpson K.L., Blackhall F., Dive C, & Malliri A. (2021). TIAM1-RAC1 promote small-cell lung cancer cell survival through antagonizing Nur77-induced BCL2 conformational change. Cell Reports, 37(6), 109979.

+ Open protocol

+ Expand

Lentiviral Transduction of Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pHAGE-ATP5G plasmids were generated by direct PCR and PCR fusions; and the point mutation plasmids generated using Q5 site-directed mutagenesis (New England Biolabs, Beverly, MA, USA). For lentiviral transfection, the plasmids with packaging plasmids were co-transfected into HEK293FT (with a ratio of 2:1.5:1.5) using Turbofect reagent (Thermo Fisher Scientific Inc, Waltham, MA, USA) according to the manufacturer’s instructions. Lentivirus-containing medium was filtered from the post-transfection supernatant and used for transduction of HEK293T cells or mouse NPCs. All lentivirus-infected cells were cultured in the medium containing Polybrene (4 μg/ml; Sigma Aldrich, St. Louis, MO, USA) for 8 hr before changing media. Forty-eight hours after transduction, the cells were selected with 10 µg/ml Blastidicin S (Thermo Fisher Scientific Inc).

Singhal N.S., Bai M., Lee E.M., Luo S., Cook K.R, & Ma D.K. (2020). Cytoprotection by a naturally occurring variant of ATP5G1 in Arctic ground squirrel neural progenitor cells. eLife, 9, e55578.

+ Open protocol

+ Expand

Construction and Validation of Pif1 Mutants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PIF1 promoter was excised from plasmid pVS102 (16 (link)) by digestion with PspXI and AgeI (New England Biolabs, NEB) and then cloned into plasmid pMB282 (CEN ARS TRP1) containing PIF1 with a C-terminal 3xFLAG tag (32 (link)). The resulting plasmid referred to as pCG17 was verified by restriction enzyme digestion and DNA sequencing and used as the target plasmid for mutagenesis. Mutations within the conserved Pif1-family SM were generated in pCG17 using QuikChange Lightning Site-directed Mutagenesis (Agilent Technologies), Q5^® Site-directed Mutagenesis (NEB) or cloned in using gBlocks^® gene fragments (Integrated DNA Technologies) and the Gibson Assembly^® method (NEB). Mutations were verified by NotI and AvaI restriction enzyme digestion (NEB) and DNA sequencing. The SM mutations analyzed in this study are listed in Figure 2C.

Geronimo C.L., Singh S.P., Galletto R, & Zakian V.A. (2018). The signature motif of the Saccharomyces cerevisiae Pif1 DNA helicase is essential in vivo for mitochondrial and nuclear functions and in vitro for ATPase activity. Nucleic Acids Research, 46(16), 8357-8370.

+ Open protocol

+ Expand

CRISPR-Cas9 Genomic Editing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 200 bp DNA sequence that contained the desired cut site was submitted to the optimized CRISPR Design online tool (http://crispr.mit.edu/) to predict single-guide RNA (sgRNA) sequences. To enhance gene-editing efficiency, we selected a 5′ N₁₈GGNGG sequence (Farboud and Meyer 2015 (link)) as an sgRNA targeting site for both oig-1 and lev-10. For oig-1, 5′-GGAGAGAAAGACGAAAATGG-3′ was cloned into pDD162 (#47549; Addgene), a plasmid that contains the sgRNA backbone and Cas9 expression system, using Q5 site-directed mutagenesis (New England Biolabs, Beverly, MA). Similarly, for lev-10, 5′-ACGAATCGACTGGTGGCCGG-3′ was used as the sgRNA target sequence, which is ∼80 bp upstream of the lev-10 stop codon.

He S., Cuentas-Condori A, & Miller DM I.I.I. (2019). NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. Genetics, 212(2), 387-395.

+ Open protocol

+ Expand

Androgen Receptor Binding Site Reporter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Firefly luciferase reporter vectors harboring the AR binding site of the MLPH gene, with the major T allele of SNP rs11891426:T>G, were constructed according to the procedures previously described (Bu, et al., 2013a (link)). Briefly, the MLPH ARBS was PCR amplified using primers F: 5′-TATCCAACACACGGGCTGAT -3′ and R: 5′-AGCTTTGGGGATTTCATTTCA -3′, purified and first ligated to the PCR fragment cloning vector PSC-B (Agilent Technologies, Santa Clara, CA) and then inserted into the KpnI/SacI sites of the PGL3 promoter luciferase reporter plasmid (Promega, Madison, WI). The minor G allele counterpart of the reporter vector or mutations of the two putative androgen-responsive elements (AREs) were generated using the QuikChange II site-directed (Agilent) or the Q5 site-directed mutagenesis (NEB, Ipswich, MA) kits. Primers used for mutagenesis were 5′-CAGCTCCCTGCTGCCAGCCTGGGG′ for G allele alteration, 5′-GCTTCCAGCCTGGGGTGCGTTCTGCACGCCTCCCTGAAATG for mutation of AR binding motif 3 and 5′-GCCAGCCCACAGCGTTCTGCACGCAGCCTGGGGTGGGAC for mutation of AR binding motif 2.

Bu H., Narisu N., Schlick B., Rainer J., Manke T., Schäfer G., Pasqualini L., Chines P., Schweiger M.R., Fuchsberger C, & Klocker H. (2015). Putative Prostate Cancer Risk SNP in an Androgen Receptor‐Binding Site of the Melanophilin Gene Illustrates Enrichment of Risk SNPs in Androgen Receptor Target Sites. Human Mutation, 37(1), 52-64.

+ Open protocol

+ Expand

Proline Analog Incorporation Using ProRS Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Note: We describe one possible cloning approach below; however, other cloning approaches may be more appropriate depending upon the situation; see Note 1.
Note: Efficient incorporation of some proline analogs requires ProRS mutants (e.g. ProRS-C443G has been used to incorporate ncPro Pip, Table 1). These mutations can be prepared via standard site-directed mutagenesis techniques (e.g. QuikChange, Agilent; or Q5 Site-Directed Mutagenesis, NEB).

Breunig S.L, & Tirrell D.A. (2021). Incorporation of proline analogs into recombinant proteins expressed in Escherichia coli. Methods in enzymology, 656, 545-571.

+ Open protocol

+ Expand

Amyloidogenic Light Chain Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All gene sequences were synthesized by IDT (Coralville, IA) with the exception of the V-domain of WIL, which was generously provided by Dr. Steve Bourgault of Université du Québec à Montréal. We previously measured the stabilities of ALLC-FL and JTO-FL [11 (link)]. The V-domains of JTO, WIL, 6aJL2 and 6aJL2 R25G have been studied previously [25 (link), 42 (link)]. The sequence of 6aJL7AL was chosen from a study of sequence determinants of amyloidogenicity [12 (link)], and the gene was synthesized from the Genbank entry AF490967. Full-length light chain genes included the human CL3 C-domain sequence, and were cloned into a construct derived from pDEST-14 (Thermo Fisher, Carlsbad, CA), under the control of a T7 promoter. V-domains were cloned into pET-22 (EMD Millipore, Billerica, MA), fused to the E. coli pelB leader sequence. Mutagenesis was carried out using either QuikChange (Agilent, Santa Clara, CA) or Q5 Site-Directed Mutagenesis (NEB, Ipswich, MA) according to the manufacturers’ instructions.

Morgan G.J, & Kelly J.W. (2016). The kinetic stability of a full-length antibody light chain dimer determines whether endoproteolysis can release amyloidogenic variable domains. Journal of molecular biology, 428(21), 4280-4297.

+ Open protocol

+ Expand

Generation of CRISPR-Engineered Toxoplasma Mutants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the primers and plasmids used in this study are listed in Table S2 and Table S3. The CRISPR plasmids were generated for targeted identification and knockdown by replacing the UPRT targeting guide RNA (gRNA) in pSAG1-Cas9-sgUPRT with corresponding gRNAs, using Q5 site-directed mutagenesis (New England Biolabs) (26 (link), 36 (link), 37 (link)). The rest of the plasmids were constructed by multi-fragment ligation using the ClonExpress II one-step cloning kit (Vazyme).
The linearized homologous fragment pTet-off::TgAAC1-Ty was used to replace the TgAAC1 promoter with DHFR::TetO7. Then the iTgAAC1 mutant strain was constructed by transfecting pSAG1-CAS9-sgAAC1 and homologous fragment into TATi strain. Transfectants were selected with 1 μM pyrimethamine (DHFR) (38 (link)). The corresponding gene-specific CRISPR plasmid pSAG1-CAS9-sgAAC2 and homologous template were co-transfected into RHΔhxgprt to construct AAC2 knockout strain and selected with 30 μM chloramphenicol (CAT) (37 (link)). The Com-TgAAC1 and Com-MusANT2 strains were generated in the UPRT locus using pSAG1-Cas9-sgUPRT plasmid and the respective CDS linear fragments. The CDS of mouse ANT2 was amplified using cDNA from RAW264.7 as a template.

Qian J., Zhao T., Guo L., Li S., He Z., He M., Shen B, & Fang R. (2023). Mitochondrial ADP/ATP Carrier 1 Is Important for the Growth of Toxoplasma Tachyzoites. Microbiology Spectrum, 11(3), e00040-23.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!